Design Strategies Impulse Sustainable Facades Vol. 4

DESIGN

STRATEGIES

SPECIAL ISSUE Impulses from teaching and research

04.2025

SUSTAINABLE FAÇADES

volume 4 ISSN (Print) 2943-4459

ISSN (Online) 2943-4467

Winter Semester Report

EDITORIAL

Dear Readers,

Welcome to the fourth volume of Sustainable Façades, a Special Issue of the

Design Strategies Magazine published by the Institute for Design Strategies

of TH OWL. Over the past two years, our Editorial Team has undergone slight

changes that we believe have enhanced the quality of this magazine. From

inviting contributors beyond our university to incorporating reviewers for quality

checks, we aim to expand our reach, engage a broader audience, and spark

curiosity across the wide spectrum of topics related to sustainable design and

construction.

In this issue, we feature contributions with perspectives from about a dozen

nationalities, developed within Germany (TH OWL, Schüco International KG,

Werner Sobek AG, DOCOMOMO) and the Netherlands (TU Delft). We continue to

extend an open invitation to other members of our academic and professional

network for future editions.

As always, we present a diverse range of articles exploring multiple aspects of

the construction industry, with a particular focus on the building envelope and its

performance in terms of building physics, carbon footprint, efficient assessment

methods, and cultural implications. In addition, as technology continues to

reshape the built environment, we acknowledge the increasing role of artificial

intelligence and robotics alongside a growing awareness of the value of existing

buildings, highlighting the need for holistic approaches that balances cuttingedge

advancements with the preservation and adaptation of our built heritage

and ancestral knowledge.

We hope this issue inspires new perspectives on the intersections between

research, policy, and practice, and how they shape the future of our cities to

ensure environmental protection, economic growth, and social justice.

Alvaro Balderrama Chiappe

M.Eng., Dipl.-Arch., LEED

Daniel Arztmann

Prof. Dipl.-Ing., M.Eng.

EDITORIAL VORWORT

Design Strategies IMPULSE – Sustainable Façades vol.4

3

CONTENTS

1. INTRODUCTION

6

2. LATEST RESEARCH

8 – User Interaction with Smart Glazing: The Effect of Switching Speed Under Overcast Sky Conditions

Pedro Pablo de la Barra Luegmayer, Alessandra Luna Navarro, Eleonora Brembilla, Mark Allen, Ulrich Knaack & Mauro Overend

10 – Noisy Buildings: Review and Case Studies of Sound-Emitting Façades

Alvaro Balderrama

3. ARTICLES

13 – Corvey Digital Identification

Thomaz da Silva Lopes Vieira, Aram Badr, Luis Alfonso Gutierrez Suarez,

Supervisors: Yvonne-Christin Knepper-Bartel, Jens-Uwe Schulz

22 – Exploring Visual Features and Perception of Façades in Residential Neighborhoods of Detmold

Alvaro Balderrama

32 – Hidden Steel Structures in Modern Sacred Architecture: Integrating Academic Opportunities with

Research

Najmeh Najafpour, Prof. Dr.-Ing. Uta Pottgiesser

39 – Circular Facade Design: The Importance of end of life scenarios to reduce environmental Impact

Abdelrahman Badr

Supervisors: Prof. Dipl.-Ing. Daniel Arztmann, Dipl.-Ing. Florian Starz, MSc Carmen Herrmann

46 – Energy Efficiency and Environmental Impact in Façade Renovation Strategies for Modern Sacred

Architecture

Najmeh Najafpour

Supervisors: Prof. Dr.-Ing. Uta Pottgiesser, Prof. Dr.-Ing. Susanne Schwickert

55 – Integrating Machine Learning with Circular Economy

Bahareh Hemmatikhanshir

64 – Façade Performance and Architectural Design

Sara Hemmatyar

4 CONTENTS


4. MID DESIGN CONCEPTS

71 – MID 1040: Sustainability, Climate and Comfort

Lecturers: Alvaro Balderrama, Manfred Starlinger, Prof. Daniel Arztmann

72 – MID Student Posters:

Anastasiia Krasnikova

Aashish Singh

Bishal Sunar

Erik Karimov

Esraa Ahmed

Kavyashree Govil

Mansi Aggarwal

Marie Al Helou

Nitesh Shresth

Sara Hemmatyar

Sylivia Kanyora

Dila Dil

Omar Shazi Alikkal

Zahra Parsafar

Zahra Tahmasbi

5. EVENTS

103 – Visit to Schüco’s Headquarters / Hands-on Workshop (FWS 50)

104 – Visit to AGC Interpane

105 – Visit to Schüco’s Headquarters / Hands-on Workshop (AOC)

106 – MID Students at BAU 2025

107 – Presentation at 23rd Docomomo Germany Conference

6. IMPRINT

108

CONTENTS


5

1. INTRODUCTION

While innovation plays a crucial role in advancing

sustainable development, the value of construction

methods and materials that have already proven

their worth over time should also be recognized.

Our cover for this Winter Semester Report features

the “Neuer Krug“ in Detmold, a building that

exemplifies aspects of sustainability that are not

always considered nowadays: the preservation of

existing structures, the continuation of traditional

construction and maintenance techniques, and the

respect for local identity.

The Neuer Krug, located at Neustadt 26, has a

long history as a place of hospitality and cultural

significance. Its origins trace back to 1709, when

Count Frederick Adolph of Lippe-Detmold gifted

his wife, Amalie, a plot of land along the newly

constructed Friedrichstaler Kanal. This gift included

authorization to establish an inn, leading to the

creation of the original Neuer Krug. In 1880,

innkeeper Heinrich Dütemeyer acquired the

property and initiated significant expansions. He

commissioned master builder Philipp Knollmann

to construct a new building, resulting in the halftimbered

structure completed in 1889, which still

stands today. Knollmann‘s design was inspired by the

Altes Haus in Bacharach, featuring decorative timber

framing, overhanging gables, and an octagonal

turret in the corner, reflecting the architectural style

of that era.

The Neuer Krug evolved into a vibrant cultural hub,

attracting not only travelers but also artists and

students from the nearby Detmold Academy of Arts

and Crafts (now known as the Detmold School of

Design). Among its notable visitors was the painter

Otto Albert Koch (1866–1921), who, during his time in

Detmold, adorned the inn‘s interior with oil paintings

as payment for his consumption at the inn. Several

of Koch‘s paintings remain preserved within the

establishment to this day.

In 1893, a beer hall was added north of the main

building, constructed in timber by local carpenter

Wilhelm Schmidt. By 1898, the beer hall served as

the foundation for the Detmold Summer Theater

(Sommertheater), further establishing the Neuer

Krug‘s status as a cultural landmark.

Despite various modifications over the years,

including the whitewashing or removal of some

interior artworks, the Neuer Krug has retained

much of its historical character. During the second

half of the 20th century, the building underwent

adaptations to meet evolving needs, with updates

such as improved windows and heating systems

ensuring compliance with modern regulations while

maintaining its essential character. Today, it is a

listed building (A216) and continues to reflect the

city’s cultural heritage.

From a sustainability standpoint, the longevity of

the Neuer Krug serves as a powerful reminder

that the lowest carbon footprint often belongs

to the buildings that already exist. Unlike many

contemporary structures that face demolition within

decades, buildings like this continue to serve their

purpose with relatively low intervention.

The Neuer Krug is featured in this volume of

Sustainable Façades to explore how historical

buildings contribute to contemporary discussions

on sustainability. The economic viability of such

structures lies in their ability to remain functional,

adaptable, and embedded in the cultural fabric

of their surroundings. Traditional materials and

construction techniques can offer valuable

insights for contemporary sustainable design,

demonstrating how craftsmanship and longevity

can inform advancements in façade technology,

energy efficiency, and materials selection. Perhaps,

sustainability is not about choosing between past

and future, but rather about integrating the best

solutions across different eras to create resilient,

efficient, and meaningful buildings.

References

Geoportal Detmold. (n.d.). Denkmal: Neuer Krug (A216).

Retrieved March 3, 2025, from https://geoportal.detmold.

de/130e/api/v1/ext/fda_denkmal/?id=A216

Stiewe, H. (2004). Das Sommertheater am „Neuen

Krug“ in der Detmolder Neustadt. In Detmold um 1900

– Dokumentation eines stadtgeschichtlichen Projekts

(Sonderveröffentlichungen des Naturwissenschaftlichen

und Historischen Vereins für das Land Lippe, Band 72, pp.

441–479). Aisthesis Verlag.

Strohmann, D. (2010). Ölgemälde zur Tilgung einer

Kneipenschuld: Werke des Kunstmalers Otto Albert

Kochs (1866–1921) im „Neuen Krug“. Denkmal-Zeitung, 12

September 2010. Retrieved March 3, 2025, from https://

www.nhv-lippe.de/fileadmin/user_upload/baende-lm/

Strohmann.pdf

Neuer Krug. (n.d.). Geschichte des Neuen Krugs. Retrieved

March 3, 2025, from http://www.neuerkrug.de/Geschichte/

6

INTRODUCTION


2. LATEST RESEARCH

7

Latest Research

User Interaction with Smart Glazing: The Effect of Switching Speed

Under Overcast Sky Conditions

Summary of paper published in February 2025 at the Building and Environment Journal, Volume 270

Link: https://doi.org/10.1016/j.buildenv.2024.112409

Pedro Pablo de la Barra Luegmayer 1 , Alessandra Luna Navarro 1 , Eleonora Brembilla 1 , Mark Allen 1 , Ulrich

Knaack 1 & Mauro Overend 1

1. Faculty of Architecture and the Built Environment, Delft University of Technology, Julianalaan 134, 2628 BL Delft, The Netherlands

Summary

As buildings increasingly incorporate smart

technologies to improve energy efficiency

and occupant comfort, dynamic façades and

switchable glazing have emerged as promising

solutions. These technologies dynamically

regulate daylight, solar heat gain, and privacy,

reducing energy consumption and enhancing

indoor environmental quality. However, a

major challenge remains: user acceptance.

Automated smart glazing systems often operate

without direct user input, which can lead to

dissatisfaction, override behaviors, and reduced

effectiveness in real-world applications. While

previous research has explored user interaction

with automated shading and lighting systems,

limited studies have focused on how users

perceive and react to different transition speeds

and directions in switchable glazing, particularly

under overcast conditions where glare is not

a primary concern. This study aims to fill this

knowledge gap by investigating how the speed

and direction of transitions in liquid crystalbased

smart glazing affect user perception,

satisfaction, and behavior. Understanding these

interactions is crucial to improving the design

and implementation of smart glazing systems

to enhance both user comfort and energy

efficiency.

Participants could manually override the

automated transitions, and their responses were

assessed through questionnaires, behavioral

data, and facial action unit (FAU) analysis.

Research Methodology

The experiment was conducted in a mobile

laboratory (Figure 1) featuring a liquid crystal

dynamic glazing system with two transition

speeds: fast (1 second) and slow (10 seconds).

Thirty participants were exposed to four

scenarios, varying both transition speed and

direction (from dark to clear and vice versa).

Figure 1. (up) floor plan of mobile laboratory; (down)

view of the interior of the mobile laboratory.

8 LATEST RESEARCH


Key Findings

1. User Perception Remained Unchanged

Participants reported similar levels of satisfaction

across all transition scenarios, indicating that

neither the speed nor direction of transitions

significantly impacted their overall perception of

the environment.

2. Override Behavior Was Influenced by

Transition Direction

More users manually overrode the system when

the glazing transitioned from dark to clear,

suggesting a preference for maintaining a darker

environment under overcast conditions.

3. Faster Transitions Increased Override

Frequency

Regardless of direction, faster transitions

resulted in more frequent overrides, likely due

to the abrupt nature of the change, which may

have been perceived as disruptive (Figure 2).

Figure 2. Time of response of users that have

overridden the façade state.

4. Gaze Behavior Indicated Distraction

Participants consistently directed their gaze

toward the glazing during transitions, regardless

of speed, highlighting a potential distraction

effect (Figure 3).

5. Facial Action Units Revealed Emotional

Responses

FAUs indicated a detectable response to glazing

transitions, though they were not significantly

correlated with user satisfaction.

6. Clustering Analysis Suggested Individual

Differences

Participants grouped by their familiarity

with smart glazing and preferences showed

variation in override behavior, but self-reported

preferences did not strongly predict actual

interactions with the system (Figure 4).

Figure 3. Box-plots to evaluate differences between

users‘ gaze angle during the switching of the glaze

and the rest of the time, and for different speed of

switching.

Implications for Smart Glazing

Design

The study shows the impact of transition

strategies on user discomfort and distraction.

While perception remained largely stable,

behavioral responses indicate that sudden

or undesired transitions can disrupt user

experience. Future designs should consider

customizable transition settings to enhance

acceptability. Additionally, further research could

explore imperceptible transitions and broader

environmental conditions to refine smart glazing

operation for real-world applications.

By integrating user-centered design principles,

smart glazing technologies can be optimized to

improve both energy efficiency and occupant

satisfaction, fostering broader adoption in the

built environment.

Figure 4. Boxplot of the cluster analysis: Cluster

1 represents users that override the automated

control only when the glazing was turned at the

darkest state; while Cluster 2 represents users

that override the automated control only when the

glazing was turned clear.

LATEST RESEARCH


9

Latest Research

Noisy Buildings: Review and Case Studies of

Sound-Emitting Façades

Summary of paper published in October 2024 at the Conference Urban Planning & Architectural Design for Sustainable Development

(UPADSD) – 9th Edition, Florence

Link: https://www.researchgate.net/publication/386552221_Noisy_Buildings_Review_and_Case_Studies_of_Sound-Emitting_Facades

Alvaro Balderrama 1,2

1. Detmold School of Design, University of Applied Sciences and Arts (TH OWL), Emilienstraße 45, 32756 Detmold, Germany

2. Architectural Façades and Products Research Group, Department of Architectural Engineering and Technology, Faculty of Architecture and the Built

Environment, TU Delft, Julianalaan, 134, 2628 Delft, The Netherlands

Summary

With the continuing densification and expansion

of cities in the past decades, urban areas

worldwide are facing unprecedented challenges,

such as an increasing population, environmental

contamination, and the impacts of climatic

events. These issues often drive the development

of autonomous buildings, yet little attention is

given to how these technologies contribute to

noise pollution.

Figure 1. Façade of the Hof der Elemente in

Dresden, Germany. (photo credit: R. Yeap, 2021).

Literature Review: Façades as Sound

Sources

Façades are traditionally studied for their roles

in sound reflection and absorption, but their

potential to emit sound remains unclear. The

following synthesis organized for literature

studies based on the origin of sound produced

at the façade, following the prevailing theory of

sound categorization by Gage et al. (2004) with

three distinct groups: geophonic, biophonic, and

anthrophonic sources.

Figure 2. Green façade between Bandelstraße and

Palaisstraße in Detmold, Germany.

Geophysical Sources – Airborne and structureborne

sounds such as wind-induced noise and

vibrations, thermal expansion of materials, and

precipitation noise like rain (Figure 1 – façade

that introduces geophysical sounds).

Biological Sources - Façades do not produce

biological sounds directly but can encourage the

presence of birds, insects, and other organisms

through green infrastructure (Figure 2 – façade

that can nurture biological sources).

Figure 3. Façade of Building 2 (the Riegel) with

integrated louvers, motorized and deployed

down when light levels are too high or rolled up

otherwise.

10

LATEST RESEARCH


Anthropological Sources - Noise from human

activities, such as mechanical sounds from

HVAC systems, motorized shading devices, or

electroacoustic systems like loudspeakers and

multimedia façades (Figure 3 – façade with

motorized shading system).

Case Studies in Santa Cruz, Bolivia

In order to provide examples of sound-emitting

façades, site visits were conducted in the city of

Santa Cruz de la Sierra, Bolivia from December

2023 to July 2024. Three buildings in the city

were selected due to their similarity as highrise

buildings in lower environments, all of

them being located over major roads, and all

producing a different type of sound.

Ambassador Business Center - A 90-meterhigh

office tower with a perforated metal mesh

façade on opposing sides (Figure 4). Santa Cruz

is a windy city and reports suggest the façade

produces a whistling sound in high winds.

Interviews with local residents and occupants

revealed that they are aware of the whistling, and

mainly consider the sounds annoying, however

some found it neutral and even pleasant.

Figure 4. (Left) Ambassador Tower from the

opposite side of San Martín Avenue; (Right) Main

entrance and metallic mesh.

Courthouse (Palacio de Justicia de Santa Cruz

de la Sierra) – A 100-meter-high office building

with numerous split-system air conditioner

units (Figure 5). Noise from air conditioning

compressors is notable at ground level, and

even along surrounding streets, raising concerns

about public health and wellbeing.

Aqua Tower - A residential building with

storefronts on the ground level, including a large

LED screen that emits sound along with video

advertisements. The impact of this multimedia

façade on the local soundscape remains unclear,

as well as its efficacy for increasing commercial

activity.

Figure 5. (Left) Courthouse tower with black

metallic mesh covering hundreds of air conditioning

compressors; (Right) Main entrance to the

courthouse with hung air conditioning units.

Discussion

This paper presents a narrative literature review

classifying sound emissions produced by the

façades of buildings in urban environments,

based on the sound’s origin (geophysical,

biological, or anthropological sources).

Refining and expanding the classification of

sound emissions by façades is recommended,

as well as developing guidelines for the

assessment of façade/building noise footprint

to ease the way for designers, policy makers,

and stakeholders in the construction industry

incorporating soundscape considerations into

upcoming projects.

Figure 6. (Left) Torre Aqua from the opposite side of

the main road; (Right) Store fronts and LED screen.

LATEST RESEARCH


11

3. ARTICLES

12 LATEST RESEARCH


Corvey Digital Identification

Article

Thomaz da Silva Lopes Vieira 1 , Aram Badr 1 , Luis Alfonso Gutierrez Suarez 1 ,

Supervisors: Yvonne-Christin Knepper-Bartel 1 , Jens-Uwe Schulz 1


Abstract

The Corvey Digital Identification project aimed to digitally document and analyze the left annex of the Corvey

UNESCO World Heritage Site to support heritage conservation and adaptive reuse efforts. The project also

served as part of a feasibility study for the potential relocation of the TH-OWL Höxter Campus into the site. A

hybrid methodology was adopted, combining historical plan analysis, terrestrial and aerial photogrammetry,

and LiDAR scanning to create high-resolution architectural documentation. Various scanning technologies,

including stationary laser scanners, backpack-mounted LiDAR, and drone-based photogrammetry, were

used to capture detailed architectural elements while overcoming challenges such as limited accessibility and

complex structural configurations. The segmentation and processing of point cloud data were conducted

manually, ensuring high fidelity in the final deliverables. However, as part of an educational experiment, students

explored AI-based segmentation techniques to investigate the potential of automating facade extraction and

interior object removal. While the AI experiments did not replace manual documentation so far, they provided

insights into future research directions for optimizing heritage recording processes. Additionally, Gaussian

Splatting was tested for real-time visualization, revealing potential applications for virtual heritage experiences.

Beyond its technical contributions, the project provided valuable hands-on training for master’s students in

Computational Design, preparing them for emerging professional challenges in digital heritage documentation

and adaptive reuse planning. The findings highlight the importance of integrating traditional architectural

documentation techniques with emerging technologies, ensuring that historical sites can be preserved with

accuracy while supporting the adaptive reuse of heritage buildings.

Keywords: laser scanning, photogrammetry, revitalization heritage buildings, deep learning, point cloud

1. Introduction

1.1. Historical and Architectural

Background of Corvey

The Carolingian Westwork and Civitas Corvey,

situated along the Weser River in Höxter, Germany,

stands as one of the most significant monastic sites

from the Carolingian period. Officially designated

as a UNESCO World Heritage Site in 2014, Corvey is

recognized for its exceptional historical, cultural, and

architectural significance, offering a unique window

into the religious and political developments of early

medieval Europe (Unesco, 2014).

Founded in 822 AD under the patronage of Louis the

Pious (son of Charlemagne), Corvey was envisioned

as a major Benedictine monastery and a spiritual

and intellectual hub of the Carolingian Empire. It

was established by monks from the abbey of Corbie

in Picardy (modern-day France), who brought with

them not only religious traditions but also advanced

knowledge of manuscript production, Carolingian

art, and monastic governance. Over the centuries,

Corvey played a pivotal role in Christianizing the

Saxon region, serving as a missionary outpost and a

center of learning (ICOMOS, 2014).

1.2. Architectural Significance of Corvey

The most architecturally significant element of

Corvey is its Carolingian Westwork, which remains

one of the most well-preserved monastic west

façades from the 9th century. The Westwork, a

monumental western entrance structure, is a

defining characteristic of Carolingian and Ottonian

ecclesiastical architecture. Corvey’s Westwork is the

ARTICLES


13

only surviving example of an authentic Carolingian

Westwork, making it an architectural landmark of

exceptional historical value (ICOMOS, 2014).

The Westwork, constructed between 873 and 885

AD, exhibits the distinctive features of Carolingian

architecture:

• Two towers flanking a central structure, creating

a monumental entrance.

• A high central hall, which was likely used as an

imperial gallery for visiting dignitaries and the

emperor himself.

• A chapel on the upper floor, decorated with

frescoes that combine Carolingian, Byzantine,

and late antique influences.

• A grand entrance hall below, which served as

a transition space between the secular and

sacred realms.

livestock and food production.

• Residences for abbey employees, including lay

workers who managed day-to-day operations.

This part of Corvey exemplifies how monastic

complexes functioned as self-contained economic

and social systems, integrating agriculture,

production, and residential spaces within a single

architectural framework. Over time, as Corvey

transitioned from a monastic hub to a secular

estate, these spaces were repurposed for various

administrative and economic functions, leading to

architectural alterations and adaptations not always

documented.

The symbolism of the Westwork was highly political.

As one of the earliest examples of west-facing

imperial architecture, it was designed to visually

assert the power of the empire, embodying both

religious devotion and royal authority. The upper

gallery, where emperors and nobility would observe

the mass, reflects the close ties between church and

state in the Carolingian world.

Beyond the Westwork, the monastic complex of

Corvey evolved over the centuries to accommodate

economic, agricultural, and residential functions.

The abbey church, originally built in the basilica style,

was a grand space for worship, drawing inspiration

from Roman and Byzantine influences. Though

heavily modified over time, remnants of its original

Carolingian foundations still remain.

Later architectural modifications occurred during:

• The Ottonian period (10th–11th centuries):

The complex was expanded to accommodate

increased monastic activity.

• The Romanesque period (12th–13th centuries):

Additional chapels and extensions were built

in the Romanesque style, featuring rounded

arches and thick stone walls.

• The Baroque period (17th–18th centuries): Some

parts of Corvey were remodeled in the Baroque

style, incorporating ornate facades, frescoes,

and sculptural decorations.

1.3. The Annex and Its Functional

Evolution

The left annex of Corvey, the focus of the Corvey Digital

Identification project, represents an important yet

often overlooked part of the complex. Historically,

this section was essential for the monastery’s selfsufficiency,

serving as:

• A grain storage facility, preserving agricultural

produce from the monastic lands.

• Animal stables, supporting the monastery’s

Figure 1. Drone picture, Annex actual state.

1.4. The Urgency for Digital

Documentation and Adaptive Reuse

The Corvey Digital Identification project was initiated

to digitally document and model this annex, aiming

to achieve several key objectives:

1. Preservation of Historic Heritage: The project

sought to create a high-resolution digital record

of the building to ensure its conservation and to

support architectural revitalization efforts. This

documentation will provide a foundation for adapting

the space for contemporary use while maintaining

its historical integrity.

2. Architectural and Urban Planning Support: The

project was part of a feasibility study to evaluate the

potential relocation of the TH-OWL Höxter campus

to the Corvey site. This required precise architectural

plans of the annex to facilitate spatial planning and

financial analysis.

3. Educational and Technological Advancement:

The initiative aimed to introduce TH-OWL master‘s

students in Computational Design to advanced

digital survey techniques, including photogrammetry

and laser scanning. This provided both theoretical

knowledge and practical experience in real-world

applications.

14 ARTICLES


1.5. Scientific and Technical Relevance

The digitization of historical architecture has become

a crucial area of research in heritage science and

digital humanities (Hub, 2021). Emerging technologies

such as terrestrial and aerial photogrammetry, laser

scanning, and machine learning-driven segmentation

offer innovative solutions for precise documentation

and automated architectural modeling (Ullas

Rajvanshi, 2019). This study contributes to the field

by exploring the efficiency of these methods in largescale

heritage documentation while also integrating

deep learning techniques for automation.

2. Methodology

2.1. Analysis and Strategy Development

The Corvey Digital Identification project began with

a comprehensive analysis of historical records,

including architectural blueprints, hand-drawn

sketches, and archival documentation related to the

Corvey complex. These sources provided valuable

insight into the construction phases, modifications,

and functional transformations of the annex over

time. Since architectural heritage sites often undergo

undocumented alterations, the project aimed to

establish a comparative analysis between historical

plans and the current state of the structure to

identify discrepancies and lost features.

To complement archival research, field studies

were conducted to verify existing conditions, refine

scanning strategies, and identify potential obstacles

to data collection. These field visits involved on-site

photography, manual sketching, and preliminary

laser scanning tests to assess the accessibility of

specific areas and determine the most effective

scanning workflows for each zone. This preparatory

phase also helped in detecting architectural

irregularities, ensuring that high-priority areas were

identified before the full-scale digital documentation

process began.

A significant challenge in planning the documentation

workflow was the heterogeneous nature of the

annex, which consisted of open-plan spaces,

compartmentalized rooms, and intricate facades.

Some sections, such as large halls, posed fewer

challenges for stationary laser scanning, while

others, particularly residential spaces and storage

areas, required more agile and flexible scanning

methods. Additionally, since the annex had been

used as a storage depot over time, many architectural

elements were partially obscured by objects, boxes,

and debris, necessitating additional efforts to

filter out non-relevant elements and isolate purely

architectural details in the final dataset.

The findings from this initial phase were critical in

shaping the overall scanning strategy, ensuring that

data acquisition was both methodical and efficient.

By carefully considering the historical significance,

functional evolution, and physical constraints of the

annex, the project team developed a workflow that

balanced precision, speed, and adaptability, laying

the foundation for an accurate and comprehensive

digital reconstruction of the site.

2.2. Spatial Division for Documentation

Strategy

Given the complexity and size of the annex, a

systematic spatial division was implemented

to optimize scanning operations. The site was

divided into eight sections (A–H) based on the

existing fire protection walls, which provided a

logical segmentation framework for structured

documentation and fieldwork. This approach

ensured that the scanning tasks were distributed

efficiently, preventing redundancy, data loss, or gaps

in coverage.

The segmentation strategy also influenced the

selection of scanning techniques. Open and largescale

sections were prioritized for stationary laser

scanning, allowing for high-density point cloud data

with minimal distortion. In contrast, residential

spaces and storage areas were allocated for

backpack-mounted mobile LiDAR scanning, which

allowed for greater maneuverability and faster data

collection. The spatial segmentation also allowed for

efficient coordination between different scanning

visits, ensuring that each documented area could be

cross-referenced and integrated seamlessly into the

final dataset.

Figure 2. Masterplan, Annex actual state.

Figure 3. Master Exterior Point Cloud.

ARTICLES


15

Furthermore, the predefined sections facilitated

better alignment between manual and automated

documentation processes. Since different scanning

methods produce datasets with varying levels

of granularity, segmenting the site ensured that

manual CAD-based reconstruction efforts and AIdriven

segmentation trials remained compatible and

complementary.

dimensional accuracy in the photogrammetry point

cloud while relying on LiDAR for precise depth

representation.

2.3. Data Acquisition Techniques and

Workflow

To maximize accuracy and efficiency, a hybrid

approach combining photogrammetry, stationary

laser scanning, and backpack laser scanning was

adopted, depending on the nature of the space.

2.3.1. Façades: Combining Photogrammetry

and Backpack Laser Scanning

Documenting the exterior facades of the annex

required a workflow that captured both highresolution

textures and geometric accuracy.

To achieve this, a hybrid approach integrating

photogrammetry and backpack LiDAR scanning

was implemented, leveraging the strengths of each

method.

The backpack LiDAR scanner provided highly

accurate, dense point clouds (~2mm precision),

making it effective for capturing structural details,

irregular wall surfaces, and overall geometric fidelity.

However, since the available mobile LiDAR system

lacked color information, photogrammetric textures

were incorporated to enhance the visual fidelity of

the dataset.

To optimize data acquisition, scanning was performed

following a linear free-walking path, maintaining an

average distance of 10 meters from the façade, while

allowing for closer scanning of detailed architectural

elements, such as ornamental carvings around

entrances.

Photogrammetry was conducted in three primary

modalities: middle-range and close-range terrestrial

imaging, as well as drone-based aerial imaging. The

terrestrial images captured fine façade material

textures up to the roof gutter, while the dronebased

imaging covered roof details and upper

façade elements that were otherwise inaccessible. A

deliberate trade-off was made between minimizing

general façade distortion and capturing local depth

accuracy in the photogrammetry point cloud.

Capturing images parallel to the façade significantly

reduces global distortions, such as the ‚banana

effect,‘ which can occur when images are taken at

oblique angles. However, this approach inherently

compromised the depth accuracy of individual

architectural elements in the photogrammetric

reconstruction. Since the laser scanner provided

highly precise depth data, the decision was made to

exclusively capture parallel façade images, prioritizing

Figure 4. Challenges Photogrammetry, banana

effect.

The image acquisition strategy included the following

steps:

1. Target placement at 10-meter intervals to aid in

image alignment across multiple datasets.

2. Terrestrial photographs captured at two distances:

• 10 meters away: Parallel shots ensuring 30%

image overlap.

• 20 meters away: Additional parallel shots for

overall registration.

3. Detailed entrance scans using a semi-circular

shooting path, ensuring comprehensive capture of

ornamental features.

4. Drone imaging performed parallel to the façade

and from top to bottom.

The final integration of LiDAR point cloud data and

photogrammetric textures was conducted manually,

combining the structural precision of LiDAR scanning

with the visual richness of photogrammetry. This

process resulted in a highly detailed, geometrically

precise dataset, suitable for both architectural

analysis and heritage conservation applications.

Figure 5. General strategy for external registration.

(1) drone scans, (2) and (3) photogrammetry and (4)

scanners.

2.3.2. Interior Spaces: Categorization and

Scanning Techniques

Documenting the interior spaces of the annex

required a structured approach that accounted

for variations in room size, layout, and accessibility

constraints. To optimize data collection, a hybrid

scanning strategy was employed, dividing interior

spaces into two categories: open-plan spaces

16 ARTICLES


and compartmentalized areas. Each category was

assigned the most suitable scanning technology,

ensuring high-fidelity documentation while

minimizing data acquisition time.

The stationary laser scanner was selected for large

open-plan spaces, as it provided high-resolution,

colorized point clouds with superior geometric

precision. This method was particularly effective

for capturing architectural details in areas with

unobstructed sightlines, such as halls and large

rooms. To ensure complete spatial coverage, scanning

positions were strategically planned, with each scan

overlapping by 30–50% to facilitate seamless data

integration. While this approach yielded high-quality,

detailed spatial data, its primary limitation was time

efficiency, as each scan required approximately 10

minutes depending on the resolution settings.

In contrast, backpack-mounted LiDAR scanning

was used for compartmentalized spaces, such as

narrow corridors, small rooms, and storage areas.

This method allowed for rapid data acquisition,

significantly reducing scanning duration compared

to stationary setups. The scanner was operated

while walking at a steady pace, ensuring continuous

data capture throughout connected spaces.

However, due to the motion-based nature of this

technique, alignment issues were encountered

when transitioning between rooms, particularly

at doorways. Since real-time corrections were not

possible, these errors had to be addressed during

post-processing.

To mitigate point cloud misalignment, multiple

experimental scanning techniques were tested:

1. Center-first rotation: Upon entering a room, the

operator moved to the center and performed a 360°

rotation before proceeding.

2. Spiral walk pattern: The operator followed a

circular path along the perimeter, gradually moving

toward the center.

3. Doorway stop-and-turn: Before entering a new

space, the operator stopped at the threshold,

performed a 360° scan, then continued walking.

Despite these adjustments, none of the techniques

fully eliminated misalignment issues, making manual

corrections during post-processing essential. To

address these inaccuracies, reference photographs

and 360° panoramic images were used to verify

architectural elements, ensuring that all structural

components were accurately represented.

Additionally, hand sketches and field notes played a

crucial role in distinguishing permanent architectural

features from temporary objects, such as storage

materials and debris, which were not relevant to

the final documentation. Finally, CAD-based manual

adjustments were applied to realign misregistered

point cloud sections, refining spatial accuracy and

ensuring seamless integration between different

datasets.

Figure 6. (General strategy for internal registration,

LiDAR scanning section D).

3. Data Processing & Architectural

Plan Generation (Level 1)

Due to the limited timeframe of the project, a small

team of student workers was assembled under

direct supervision to ensure the timely delivery of

scaled 2D architectural drawings for the architecture

office responsible for the TH-OWL Höxter Campus

planning. Given the complexity of the annex and

the need for highly precise documentation, a

manual processing approach was chosen to extract

architectural features from the point cloud data with

maximum accuracy.

3.1. Manual Processing Approach

The processing workflow consisted of importing

point cloud data into CAD software (Rhinoceros),

where it was manually analyzed and converted into

floor plans and sectional drawings. This approach,

while labor-intensive, was necessary to meet the

practical requirements of the project under time

constraints.

Step 1: Data processing and Point Cloud

Generation

The point cloud generation process involved

the integration of two main tools: FARO Scene

and RealityCapture, each serving distinct but

complementary roles in processing and refining

spatial data. FARO Scene was primarily used

for handling 3D laser scans, ensuring accurate

alignment and registration of point clouds obtained

from terrestrial LiDAR and a backpack scanner. The

processing workflow included both cloud-to-cloud

registration aligning multiple scans without the use

of targets and target-based registration, which relied

on checkerboards to achieve precise alignment.

Additionally, the software facilitated data cleaning,

clipping, and cropping, allowing for the extraction of

relevant portions of the dataset. Further refinement

involved 3D mesh and surface modeling, converting

point clouds into structured models suitable for CAD

and other modeling applications.

In parallel, RealityCapture processed data captured

from cameras and drone images. Once imported,

the images were aligned to generate an initial

sparse point cloud, a crucial step in establishing

spatial relationships within the dataset. To ensure

ARTICLES


17

accuracy in reconstruction, this alignment was

then scaled using markers. The refinement process

continued with mesh generation and dense point

cloud processing, incorporating filtering techniques

and model cleanup to eliminate unnecessary data.

To enhance the visual fidelity of the model, texture

baking was applied, enriching the final output

before it was exported as either a textured OBJ

mesh or a dense point cloud in PLY format. Finally,

multiple components were merged to provide

a comprehensive, unified representation of the

building.

levels, staircases, and most importantly, the

configuration of the wooden roof trusses and

structural framework. Given the feasibility

study for potential architectural modifications,

such as the addition of insulation or a new

roofing system, understanding the load-bearing

capacity of the existing structure was crucial.

The extracted sections enabled engineers to

assess structural capacity and determine where

additional reinforcements might be required to

accommodate new architectural demands.

• Horizontal slices (floor plan sections) were

used to identify doorways, windows, and other

architectural openings at different height

levels, ensuring these features were accurately

mapped in the 2D plans.

For floor plan generation, a three-layer horizontal

slicing approach was implemented, each focusing

on different architectural components to

improve interpretation and precision in the final

documentation:

Figure 7 . (RealityCapture Photogrammetry

workflow, Drone camera position).

Step 2: Point Cloud Import and Pre-Processing

The raw point clouds were imported into Rhinoceros

(CAD software) for further processing. Given the

high density of the dataset, an initial downsampling

phase was conducted to reduce file size while

preserving critical architectural details. This process

was carried out using Cockroach, a Grasshopper

plugin specialized in point cloud optimization,

along with additional Grasshopper add-ons for

adaptive simplification. These tools enabled efficient

noise reduction and segmentation, enhancing the

distinction between architectural and structural

components.

Figure 8. (Downsampling with Segmentation).

Step 3: Slicing Methodology for Architectural

Feature Extraction

To define the structural boundaries of walls,

openings, and other key architectural elements, the

point cloud was systematically sectioned into both

vertical and horizontal slices, allowing for a more

detailed spatial analysis and feature extraction.

• Vertical slices (cross-sections) were generated

primarily for the creation of architectural

sections, providing critical insight into the

building’s structural composition. These

slices were essential in identifying floor

1. Lower Horizontal Slice (1.5m above the ground,

extending downward to the floor level):

• This slice provided a general overview of the

room’s layout, ensuring that variations in floor

levels, staircases, and sunken areas were

properly captured.

• Additionally, it accounted for window parapets to

avoid misrepresentations in elevation changes.

2. Mid-Level Horizontal Slice (20cm thickness around

1.5m height):

• The purpose of this slice was to precisely

capture the positions of windows and doors,

independent of window parapets.

• By slicing just above the parapet level, the team

avoided misinterpretations that could occur

when parapets obscure the true dimensions of

openings.

3. Upper Horizontal Slice (20 cm thickness close to

the ceiling):

• This slice ensured a clean representation of the

room’s perimeter, minimizing visual obstructions

caused by furniture and stored objects.

• Since many rooms contained large objects and

clutter, capturing a section near the ceiling

allowed for a clear definition of wall boundaries

without interference.

Figure 9. (multi-slice methodology).

18 ARTICLES


This multi-slice methodology significantly improved

the accuracy of architectural feature extraction,

ensuring that structural elements were represented

with minimal ambiguity in the final 2D drawings.

Figure 10. (Challenge caused by noise).

Figure 14. (Courtyard Facade Drawings).

Figure 15. (Architectural drawings section H).

3.2. Challenges and Considerations

Figure 11. (slice methodology, elevation and

sections).

Step 4: Hand-Tracing of Architectural Features

Once the slices were generated, the team manually

traced over the structural lines in CAD software. This

included:

• Precisely delineating walls, openings, and loadbearing

structures.

• Ensuring dimensional accuracy by referencing

point cloud depth data.

• Cross-verifying different sectional views to

maintain consistency between floors and

elevations.

This process requires a high level of attention to

detail, as misinterpretations of the point cloud data

could lead to errors in the final architectural plans.

While the manual approach ensured precision, it was

time-intensive and demanded significant effort from

the team. The primary challenges included:

1. Complexity of Structural Elements and

Misinterpretation of Furniture

• In certain sections of the annex, the complexity

was further increased by the roof structure

and numerous wooden profiles, making it even

more challenging to accurately interpret the

point cloud data. Additionally, architectural

alterations and built-in furniture complicated

the identification of actual structural walls.

Some large storage units, shelving systems,

and cabinetry were tightly affixed to walls,

making them indistinguishable from structural

elements in the point cloud data. This required

additional manual verification using field

notes, 360 panoramas, photographs, and

cross-referencing with historical plans to avoid

incorrectly mapping furniture as permanent

walls in the final architectural drawings.

2. Point Cloud Density and Noise

Figure 12. (From point clouds to 2D drawings).

• High-density scans provided detailed

information, but also introduced visual

clutter, making it challenging to isolate critical

architectural elements.

4. Research on Automation and

Deep Learning Techniques (Level 2)

Figure 13. (Orthophoto from Photogrammetry &

Drawings).

The Corvey Digital Identification project explored

AI-driven methods to automate architectural

documentation, aiming to improve segmentation

accuracy and reduce manual labor. Experimental

studies were conducted, focusing on point cloud

segmentation, object removal, and automated 2D

drawing generation.

ARTICLES


19

4.1. Automated Facade Segmentation

• Goal: Identify walls, windows, and decorative

elements in dense facade point clouds.

• Method: Applied RANSAC plane segmentation

for detecting main walls and DBSCAN clustering

to isolate architectural elements.

• Findings: Effective for large-scale segmentation

but struggled with recessed features, requiring

manual adjustments.

4.4. Automatic 2D Contour Generation

with Fresnel Node

• Goal: Automate the conversion of point clouds

into 2D elevation drawings.

• Method: Utilized Blender’s Fresnel Node to

extract object outlines based on light interaction.

• Findings: Provided a faster alternative to manual

tracing but required additional scripting for

cleaner output.

Figure 16. (Plane Segmentation + DBSCAN

Clustering, Student work: Maja Ripploh & Özge

Türedi).

4.2. Facade Segmentation & Interior

Object Removal

• Goal: Improve facade segmentation and

automate the removal of non-architectural

objects from interior point clouds.

• Method: Used Grounding DINO, SAM (Segment

Anything Model), and Mask3D for facade

classification and DBSCAN clustering for filtering

furniture.

• Findings: Successfully removed large objects

but had difficulty distinguishing built-in features

from structural walls.

Figure 17. (Deep Learning Segmentation using

ScanNet200 Dataset, Student work: Yusuf Aykin).

4.3. Photogrammetry vs. Gaussian

Splatting for Documentation

• Goal: Compare photogrammetry and Gaussian

Splatting (GS) for architectural documentation.

• Method: Used RealityCapture for

photogrammetry and PolyCam & SuperSplat for

GS.

• Findings: Photogrammetry produced highaccuracy

meshes but required significant

computation, whereas GS enabled realtime

visualization but lacked precision for

documentation.

Figure 18. (Object contours vary based on viewing

angles).

5. Discussion

The Corvey Digital Identification project

demonstrated the effectiveness of hybrid digital

documentation, integrating manual CAD-based

processing with optimization algorithms and AIdriven

segmentation techniques. The results

highlight both the strengths and limitations of

these approaches in heritage documentation and

architectural analysis.

5.1. Accuracy and Efficiency in Manual

vs. Automated Processing

The manual CAD workflow produced precise

architectural drawings, particularly in floor plan

and section extraction, but was labor-intensive.

Optimization and AI-driven segmentation algorithms

showed promise in automating feature extraction,

particularly for object segmentation and interior

cleaning. However, these techniques struggled

with complex architectural details (e.g., embedded

windows, built-in furniture, and decorative elements),

requiring manual refinements.

While AI cannot yet replace manual documentation,

hybrid workflows—where optimization and/or AI preprocesses

point clouds before human verification—

can significantly reduce manual effort and enhance

efficiency in large-scale projects.

5.2. Challenges and Future Directions

in AI-Assisted Heritage Documentation

Automating architectural segmentation proved

challenging due to the complexity of historical

structures, where architectural elements often blend

into their surroundings. The project underscores AI’s

growing role in architectural documentation, while

emphasizing the need for hybrid workflows that

20 ARTICLES


balance automation with manual expertise.

• Facade segmentation effectively isolated main

surfaces but struggled with recessed elements

due to overlapping planes.

• Interior object removal successfully eliminated

large furniture but had difficulty distinguishing

built-in features from structural walls.

• Further AI training: Developing custom

datasets for historical buildings could enhance

segmentation accuracy, improving feature

extraction and classification. Combining AIbased

detection with manual validation can

improve efficiency without compromising

precision.

• Gaussian Splatting revealed high potential for

real-time visualization, making it particularly

useful for interactive heritage applications, as its

high-speed rendering and photorealistic scene

representation allow for seamless immersive

virtual tours, enabling users to explore historic

spaces interactively in VR or web-based

platforms without the computational limitations

of traditional 3D mesh models, offering a

scalable and efficient solution for remote cultural

heritage experiences and digital preservation.

6. Conclusions

The Corvey Digital Identification project successfully

documented and digitized the left annex of the

Corvey UNESCO site, producing precise architectural

floor plans and sections that supported the

Höxter campus feasibility study. The manual CAD

workflow ensured high-quality deliverables, while

the experimental AI-driven research provided

insights into automation possibilities for heritage

documentation.

Beyond its technical achievements, the project

also played a crucial role in education, introducing

master’s students in Computational Design to

cutting-edge digital documentation techniques,

including photogrammetry, LiDAR scanning, and

AI-based segmentation. By engaging students

in real-world challenges, the project provided

hands-on experience with emerging technologies,

preparing them for the evolving demands of the

professional architectural and computational design

industries. The integration of manual and AI-driven

workflows allowed students to critically assess the

limitations and potential of automation in heritage

documentation, equipping them with a balanced

perspective on traditional and future methodologies.

While manual processing remains essential for

accuracy, the experiments with machine learning and

optimization-based segmentation demonstrated

the potential for automation in feature extraction,

object removal, and facade segmentation. Future

work should focus on refining AI models with

architectural datasets, integrating hybrid workflows,

and leveraging real-time visualization techniques

such as Gaussian Splatting for immersive digital

heritage applications.

7. Acknowledgments

This project was made possible through the

dedication and collaboration of a multidisciplinary

team, including faculty members, research assistants,

and master’s students. Their collective expertise

and commitment to digital heritage documentation,

computational design, and adaptive reuse strategies

were essential to the success of the Corvey Digital

Identification project.

Project Managers

• Dipl. Arq/Urb M. Eng. Thomaz da Silva Lopes

Vieira

• Prof. Dr. Ing. Yvonne-Christin Knepper-Bartel

• Prof. Dipl. Eng. Jens-Uwe Schulz

Student Research Assistants

Special thanks to our research assistants for

their invaluable contributions to data acquisition,

processing, and documentation:

• Luis Alfonso Gutierrez Suarez

• Aram Badr

External Support

We also extend our gratitude to:

• Yingwen Yu (PhD Candidate - TU Delft)

for generously providing access to the backpack

laser scanner and collaborating with us during the

digital documentation phase.

Master’s Students – MID S9 Course

A heartfelt appreciation goes to the master‘s

students of the S9 course, whose dedication to

exploring digital heritage methodologies and AIassisted

segmentation brought valuable insights to

the research:

• Maryam Nafez, Zahra Mohebbi, Mostafa Hamdy,

Edgardo Rodriguez Altamirano, Shinu Thomas,

Omar Abdelhady, Marzie Molaei Maqsoudbeki,

Maja Ripploh, Türedi Özge, Rebal Jaber, Israfil

Taslibeyaz, Aykin Yusuf, Acar Kiymet, Salah EL

Kassar, Elizabeth Parejo.

Their contributions in field data collection,

computational experimentation, and architectural

documentation were instrumental in achieving the

project’s objectives.

8. References

Hub, H. R. (2021). Digital technology and heritage:

Challenges and issues. s.n.

ICOMOS. (2014). Nomination dossier: Carolingian Westwork

and Civitas Corvey, inscribed, s.l.: ICOMOS - International

Council on Monuments and Sites Paris, ICOMOS.

Rajvanshi, U., & V. R. V. (2019). Automatic generation of floor

plans for indoor navigation using. s.n.

UNESCO. (2014). UNESCO World Heritage Convention.

https://whc.unesco.org/en/list/1447/

ARTICLES


21

Article

Exploring Visual Features and Perception of Façades in Residential

Neighborhoods of Detmold

Alvaro Balderrama 1,2


2. Architectural Façades and Products Research Group, Department of Architectural Engineering and Technology, Faculty of Architecture and the Built

Environment, TU Delft, Julianalaan, 134, 2628 Delft, The Netherlands

Abstract

The visual perception of building façades plays a crucial role in shaping human experience in cities, and the debate

of concepts like aesthetics, beauty and visual quality have been going on for centuries. However, systematic

methods for assessing the visual features of buildings and their emotional impact remain underdeveloped. This

study presents an exploratory methodology for assessing the visual features and visual perception of residential

façades. Taking houses of the 32756 area of Detmold, Germany, the research primarily aims to test and refine

methods for surveying both objective visual attributes and subjective perceptual responses. A database of

façade photographs was created following predefined selection criteria, and two consecutive surveys were

conducted focused on 20 façades. In the first stage, participants (n=22) generated descriptive terms to capture

natural emotional reaction to photographs of different façades; in the second survey, a different group (n=12)

rated façades using bipolar scales, first with 23 visual features and 25 perceptual attributes. The results show

patterns between the physical characteristics of façades and their affective descriptors (e.g. pleasantness and

cleanness, safety, and vegetation). While findings reveal a series of relationships between visual features and

perceptual scales, the primary goal of the study was to test the approach of gathering visual and perceptual

data with small groups of professionals. Future research could build on this methodology by expanding the

sample size, refining survey instruments, and applying statistical modeling techniques to better understand the

links between visual features and human perception of façades.

Keywords: residential buildings, cityscape, view, vision, sight, aesthetics

1. Introduction

The visual perception of building façades plays a

critical role in shaping our urban environments and

influencing how people experience architecture

(Scruton, 1979). While the functional aspects of

façades such as structural integrity and energy

performance are well regulated, their visual

qualities remain more subjective and harder to

quantify. With increasing attention being paid to

the relationship between architectural design and

human experience, understanding how people

perceive façades becomes essential for architects,

urban planners, and researchers in environmental

psychology.

The façades of buildings act as an interface between

outdoor and indoor areas, influencing how we

interpret the spaces around us (Knaack et al., 2007).

The word façade’s etymological origin stems from

Latin ‘facies’, which means face, and generally refers

to the exterior face of a building (Bahar et al., 2022).

The façade not only acts as a barrier separating the

interior from the exterior, but constitutes the most

prominent element of building design, defining its

aesthetic character and conveying symbolic meaning

(Lovell 2010). The design of façades, therefore, is a

critical component in environmental comfort (Klein,

2013). The aesthetic of our built environment is an

important aspect for the design of human-centered

cities, but a problem quickly arises in the presence

of clashing conceptions of what we understand to be

aesthetically pleasing, or, when is a façade beautiful

(Prieto and Oldenhave, 2021).

22 ARTICLES


This study seeks to test an exploratory methodology

for surveying façade visual features and people’s

affective response. The main research question

addressed is: how to survey the visual aspect of

façades in terms of physical visual features and

perceived affective quality? A series of sub-questions

follow up:

SQ1. How related are literature-based perceptual

descriptors and the affective language naturally

used by proficient English speakers when evaluating

façades?

SQ2. Which façades are the more and less preferred

by participants, and are there patterns that emerge

between the physical visual properties of façades

and their subjective evaluation?

SQ3. How well did the proposed indicators and

descriptors perform, and is it effective to conduct

a survey with professional participants to analyze

visual features of façades (expertise-based), as well

as perceptual affective quality (perception-based)?

2. Literature Review

2.1. Background of Visual Quality

Assessments

The visual quality of the environment has likely

influenced human decisions about site selection and

development from the very beginning of settlements

and formation of routes. According to Daniel (2001),

even in early human civilizations, appreciation for

locations with little or no association to food, water,

or shelter existed.

As described by Polat (2015), Plato (427/428 - 347

B.C.E) was the first philosopher to methodically

examine the concept of “beauty”. In Plato’s view,

beautiful things are not objects in the universe

but rather ideas that transcend the material world.

However, shortly after, his student Aristotle (384

- 322 B.C.E.) discussed a different approach that

focused on the material world and how quality exists

within objects themselves. He explored the idea

that beauty originates from order, symmetry, and

definiteness/clearness, and could be explained with

mathematics.

The term “aesthetics”, coined in the Eighteenth

Century, was developed to examine the relationship

between environmental qualities and human

sensibility. Research on the atmosphere was the focus

of this aesthetics because atmospheres constitute

the “In-between” between environmental qualities

and human sensibilities (Böhme, 2000). Aesthetics

originally designated, among other things, a kind of

object, a kind of judgment, a kind of attitude, a kind

of experience, and a kind of value; and later came

to name an entire field of philosophical research

(Stanford Encyclopedia of Philosophy, 2022).

In the construction sector, aesthetics is mainly

associated to visual quality, however by definition,

the aesthetics of a façade would not only consider

the visual aspect, but also the other senses that

affect someone’s experience in that context.

In the Twentieth Century the field of visual assessment

emerged to address planning needs arising from

policy (Daniel, 2001). The U.S. National Environmental

Policy Act of 1969 catalyzed the advancement of

a research community and subsequent policies

(USDA, 1974; USDI, 1980). As a result, for decades,

environmental management practices mainly

focused on expert-based approaches to measure

and evaluate not only which landscape condition

looks better but also by how much (Palmer and

Hoffman, 2001).

Indices of landscape quality are based on overt

choices, rankings or ratings of landscape (usually

represented with photographs) provided by samples

of human viewers. Generally, high levels of reliability

have been achieved when compared to the expert/

design approach, with the inclusion of groups of

people between 5 and 30 (Brown and Daniel, 1987;

Palmer, 1997). Changes between landscapes are

noticeable in the results of assessments that use

multiple attributes describing their interpretation

of the scenes. Studies regarding people’s visual

perception can involve the use of images (e.g.

photographs) and questionnaires designed using

the semantic differentials method, allowing them

to measure a series of attributes that describe the

visual features in the image with points in a scale.

In recent decades, the importance of perceptual

and subjective dimensions have been recognized

by researchers in environmental psychology. A

second paradigm of landscape aesthetics theory

began to develop from psychological perspectives

on landscape preference (Bourassa, 1988; Daniel

and Boster, 1976; Kaplan and Kaplan, 1989; Ulrich,

1986), diverging from the expert-based approach.

Perceptual methodologies gather human responses

through surveys, visual assessments, or interviews,

are essential for capturing the multiple ways people

interpret architectural elements.

Both paradigms now form the basis of contemporary

landscape assessment methods: the “objective”

paradigm applied in 20th-century policy, where

visual quality is inherent to landscape properties,

and the “subjective” paradigm where visual quality is

“in the eye of the beholder” (Lothian, 1999).

Daniel (2001), argued that a division between expert

descriptive methods and public preference models

is noticeable in landscape assessment research,

inherited from the philosophical debates of aesthetics

and beauty, but that visual quality assessments are

most effective when they incorporate both objective

and perceptual variables.

ARTICLES


23

2.2. Current Approaches to Visual

Quality Assessment

At the turn of the century, interest increased in

visual assessment methods with scenic beauty of

the landscape becoming an important component

of planning practices and management strategies

(Scott, 2002). The field known as Landscape Visual

Quality (LVQ) rose from the relationship between

physical properties of the landscape and the

influence of the properties on human respondents

and their perceptions. LVQ can be defined as

“relatively aesthetic excellence of a landscape” and

it can be measured through the appreciation of an

observer (Lothian 1999; Daniel 2001; De La Fuente

et al., 2006). Both qualitative and quantitative

parameters are useful to depict LVQ (Lee and Ng,

2024).

Several visual assessment protocols have been

developed, and significant advancements have been

made in assessing the visual quality of landscapes

(Gobster et al., 2019). The main current methods for

assessing landscape preference can be classified as

three approaches:

• Expert/design approach (objective paradigm)

• Perceptual/public approach (subjective paradigm)

• Expert/Public approach (psychophysical paradigm)

These categories somewhat coincide with the two

main aspects of façade aesthetics proposed by

Prieto and Oldenhave (2021) after conducting a series

of semi-structured interviews with professionals.

Intrinsic aspects pertain to the inherent qualities of

the façade itself, encompassing elements such as

composition, materiality, and detail design. These

characteristics are typically quantifiable and focus

on the façade as an autonomous object. Conversely,

extrinsic aspects involve the façade‘s relationship

with external factors, including its physical context

and the perceptions of observers, indicating the

subjective associations that contribute to aesthetic

appreciation of façades.

It is important to consider that in all the approaches,

the judgment of a human is still needed to survey

the environment, therefore, it is still very difficult

to measure fully objectively. On the other hand,

measuring perceptual constructs that are so

vulnerable to individual characteristics, also makes

subjective approaches difficult to use (Prieto and

Oldenhave, 2021).

According to Daniel (2001), the subjective approach

seems to have largely won out in modern philosophy,

with a much higher apparent accuracy in key

studies, where in the objective approach, small/

individual changes between landscape are not easily

noticeable. In the perceptual approach individual

cases are more recognizable providing wider and

more precise result. However, a reasonable and

popular resolution of the objective-subjective

controversy in the context of visual landscape

aesthetic quality assessment is to acknowledge

that quality depends on both the visual features

of the landscape and the psychological processes

(perceptual, cognitive) experienced by the observer.

Despite this acknowledgment, exactly which sensory

perceptions, cognitive interpretations, and/or

emotions/feelings are most relevant to aesthetic

quality remains a matter of debate.

2.3. Insights for developing façade

visual quality assessment methods

An overview of the research fields of landscape

visual quality (LVQ), soundscape, and other

environmental sciences provides valuable insights

into assessing the visual quality of façades in terms

of structural integrity but also of social significance.

LVQ studies acknowledge the coexistence of distinct

approaches: the objective perspective, focusing

on measurable physical attributes; the subjective

perspective, centering on human perception and

cognitive responses; and a converging operation for

a physical/psychological approach. This is somewhat

comparable to soundscape research, where the

acoustic environment is the physical aspect, and the

soundscape is the perceptual aspect.

Intrinsic aspects of façades, as described in Prieto

and Oldenhave (2021), include their geometrical

and material properties. Intrinsic attributes define

the façade as an object and determine its physical

characteristics. Extrinsic aspects consider the

relations of façades and the urban fabric, as well as

the way they influence people’s visual perception,

and through sight and other senses.

In order to develop a methodology that follows the

psychophysical approach, a convergence of both

approaches is proposed with the aim to explore

the relationship between visual features and visual

perception. Medeiros et al. (2023) proposed criteria to

ensure indicators reflect the essential characteristics

of visual quality without redundancy or excessive

complexity, however still statistically related

between the objective and subjective indicators. It is

essential to ensure that the selected indicators and/

or descriptors are not only theoretically grounded

but also adaptable to diverse architectural contexts

and scales, and with terminologies that reflect what

people say in real-world scenarios.

While LVQ traditionally relied on photographs and

static visual representations for assessments,

recent advancements in technology offer additional

opportunities. Photographic and static image-based

evaluations remain a valid and accessible method.

However, emerging technologies such as Virtual

Reality (VR) and Augmented Reality (AR) offer new

dimensions and are becoming more accessible

every year. These technologies also support

multisensory assessments, typically using binaural

sound compatible or integrated with the VR headset,

suitable for soundscape assessment (Botteldooren

24 ARTICLES


et al., 2023; Llorca-Bofí et al., 2022). Additionally,

modifying room parameters such as temperature

or air quality to analyze in the experiment is

also possible to reveal multisensory interactions

(Martinez-Alcaraz et al., 2025).

3. Methodology

Based on the growing body of literature, it can be

agreed that evaluations of the visual environment

gathered through surveys are valuable tools,

whether its among trained observers or general

public. Nevertheless, the methodological procedure

remains underdeveloped in façade-specific research.

This methodology presents an exploratory approach

to survey visual features and perceptual affect by

working with professional participants.

The participants for these surveys were recruited

by the author within the network of the university.

English proficiency was a requirement for the survey.

All participants already held professional degrees in

fields like architecture, civil engineering, mechanical

engineering, and construction. They were informed

that their participation would be entirely anonymous

and voluntary with no compensation. Informed

consent and socio-demographic data was provided

by all participants.

3.1. Photographic campaigns

A series of photographic campaigns were carried

out during September 2024 in the city of Detmold, in

the state of North Rhine-Westphalia, Germany. The

32756 postal code area was selected for this study,

since it is predominantly residential, aside from

some commercial and industrial space around the

historical city center.

A photographic database of houses was compiled

based on pre-determined criteria: (i) the façade and

building look like a house and not have distracting

billboards or texts; (ii) the building is a low-rise

construction up to a height of about 15 meters; (iii)

ideally, the building does not have a fence or front

lawn or other objects that interfere with the view

of the façade; (iv) the pictures were taken from a

perpendicular location, at an ideal distance of 10

meters (limits between 5-15 meters). Figure 1 shows

a mosaic of 110 houses after post processing to have

clear sky in every picture.

The database of façades in Detmold does not

publicly disclose the exact location of the houses

for privacy issues. The creation of the database is

justified primarily for this research project, which

includes this article and potential follow-up research.

Additionally, the database is intended to be used

for future academic purposes in the context of the

Master of Integrated Design (MID) program, and the

Institute for Design Strategies (IDS).

3.2. Survey procedure

From the total of 156 houses of the database, a sample

of 20 houses was selected for the next steps of this

paper as a pilot study. The pictures were labeled

randomly from 1 to 156. Façades 1 to 20 were used

for this pilot study. The houses were selected due to

variations in the visual character (e.g. different styles,

time of construction, materials, condition). Next, two

surveys (attribute generation, and assessment of

visual features and visual perception) were carried

out, with on-site participation in a classroom at the

Detmold School of Design in two separate days of

October 2024. Participants in a classroom had the

full-screen pictures projected on the wall, and had to

use individual laptops to carry out the assignment.

For the attribute generation survey, participants

(n=22; female 40%; mean age: 26) used the online

tool Mentimeter providing three words for each

picture.

For the survey of visual features and perception,

participants (n=12; female 50%; mean age: 25)

received a spreadsheet to input the visual features

between 0 and 2, and the perceptual values between

-3 and 3 for each façade.

3.3. Data analysis

The results of the surveys were used to create two

datasets in spreadsheet format. Then, the data was

processed using a Python code developed for this

study, to visualize the results through boxplots,

heatmaps, and bar graphs. The code will be shared

in the project’s GitHub repository “Digital Toolbox for

Façade Acoustics and Soundscape Assessment”.

4. Results

4.1. Survey for attribute generation

To identify affective descriptors relevant to the

perception of façades used by practitioners, a

preliminary survey was conducted with a first group

of twenty-two (n=22) participants. They were shown

the 20 selected photographs and asked to write

three words that described their perception of each

image.

This methodology draws the basic principle from

Axelsson’s Towards a Psychology of Photography:

Dimensions Underlying Aesthetic Appeal of

Photographs (Axelsson, 2007), where he surveyed

people in order to generate attributes that describe

visual quality to use later in the development of rating

scales to survey a second group of participants.

ARTICLES


25

26 ARTICLES


Figure 1. Samples from the database of façades.

ARTICLES


27

Boring–Entertaining, Gloomy–Cheerful, Ordinary–

Sophisticated, Common–Unique, Chaotic–

Calm, Unplanned–Planned, Simple–Complex,

Unbalanced–Balanced, Confusing–Understandable,

Not Historical–Historical, Old–New, Traditional–

Contemporary, Unsafe–Safe, Uncomfortable–Cozy,

Dark–Bright, Open–Closed, Opaque–Transparent,

and Hidden–Exposed.

4.2.1. Visual features

Figure 2. Examples of word clouds for four different

façades in the attribute generation survey.

The results provided a total 1184 entries for the 20

pictures. After removing duplicates and grouping

alike words (e.g. symmetric and symmetrical, or

pleasant and plesant and very pleasant), a narroweddown

list of 296 words was obtained. From those,

142 terms were only used one, so there were 154

terms used at least twice.

The dataset of visual features consists of quantifiable

attributes from 20 façades. The survey methodology

applied in this study was based on a scaling system

where participants rated each visual feature on

a scale from 0 to 2. The accuracy of the indicators

could be evaluated by their standard deviation,

as seen in Figure 3, where the top 3 and lowest 3

façades in terms of pleasantness are shown.

The words provided by participants without any preimposed

vocabulary resemble terminology found

in several studies presented in the literature review

(ISO 12913-3; Axelsson, 2007; Medeiros et al., 2023).

4.2. Survey of visual features and

perceptual attributes

The second survey of this research was carried out

with another group of twelve (n=12) participants and

was composed of two stages:

First, participants were shown the sequence of 20

façade pictures and had to fill-in a spreadsheet with

24 physical visual features with a scaling system of

0-2, being 0 the lack of that feature, 1 being some

presence, and 2 being a dominant feature. The final

list of visual features included: number of floors,

presence of a basement or attic, degree of symmetry,

balconies, decoration, maintenance conditions, and

materials: painted plaster, concrete finish, brick,

wood, glass, metal, stone, façade greenery, and

color tones including white, grey, black, brown, red,

orange, yellow, green, blue, and purple.

After completing the survey of visual features,

they proceeded with the visual perception survey.

They were shown the sequence of houses again,

but they were asked to rate perceptual attributes

with bipolar scales of -3 to 3, 0 being neutral. The

inclusion of these specific perceptual attributes

for the survey was guided by the criteria of having

terms that are both grounded in literature and

reflect the terms that the first group provided in

the attribute-generation survey. The subjective

perceptual dimensions, presented as bipolar

rating scales, included: Unpleasant–Pleasant,

Ugly–Beautiful, Cold–Warm, Monotonous–Vibrant,

Minimalist–Excessive, Dirty–Clean, Shy–Expressive,

Figure 3. Boxplots of visual features.

28 ARTICLES


The resulting median values for each façade are

shown in the heatmap in Figure 5, with the dark blue

being the absence of that visual feature, pink being

some presence of that feature, and yellow being a

dominant feature.

4.2.2. Perceptual attributes

In the second part of the survey, participants

evaluated the façades using a set of perceptual

descriptors organized as bipolar scales, ranging

from -3 to +3, with 0 representing a neutral or

balanced. Most perceptual descriptors showed

good usability and meaningful distinctions across

buildings. However, the variability (figure 4) in some

dimensions suggests that further refinement could

improve consistency.

Figure 6 shows a heatmap revealing the median

value for 23 perceptual scales in each façade. The

first on the left is pleasantness, being the reference

to selecting the top 3 and lowest 3 preferred façades.

Figure 4. Boxplots of visual perception.

Figure 6. Heatmap of perceptual attributes for 20

buildings.

A cross section of the heatmap along the unpleasant

– pleasant axis is shown in Figure 7. Buildings 7,

18, and 20 received the highest overall score in

pleasantness, followed by Buildings 5, 4, 11, and 20.

The lowest ranking buildings in the pleasantness

scale were Buildings 2, 3, 8, 10, and 17.

The pleasantness scale revealed general proximity

to other attributes on the positive side of the

perceptual spectrum, including beauty, cleanness,

safety, and warmth.

Figure 5. Heatmap of visual features for 20

buildings.

ARTICLES


29

5. Conclusions and Discussion

Figure 7. Median Unpleasant – Pleasant values for

20 façades.

A particularly notable finding is that the façades

ranked lowest in pleasantness (Buildings 2, 3, 8, 10,

and 17) also exhibited the lowest scores in perceptual

cleanness, and in objective maintenance condition

and the most pleasant façades (Buildings 7, 18, and

20) scored highly in condition and cleanness (figure

8).

This study explored a methodology for assessing

façade visual features and visual perception. A

literature review was conducted to identify key

studies related to visual quality assessment. Then,

a preliminary survey was conducted to identify

perceptual attributes that participants used to

describe the façades. Next, a two-part survey was

conducted, providing participants with a list of

indicators for visual features and another list of

perceptual descriptors. The results of the survey

show a generally consistent methodology with

some observations. The relation between objective

indicators and perceptual attributes is clear with

some parameters such as pleasantness and

cleanness, decoration, and vegetation.

The study provides initial insights into the

relationship between visual features and perception,

however, it does not model these relationships

statistically. Future research could expand amount

of participants and houses in the experiment for

further analysis such as dimensionality reduction

techniques like Principal Component Analysis (PCA)

and organize façade visual perception attributes into

a more interpretable model.

6. Acknowledgements

Figure 8. Median values of condition with a 0-2

scale, and cleanness with a -3 to 3 scale for 20

façades.

4.2.3. Effectiveness of the methodology

Many of the indicators and descriptors within the

framework seem to provide a reliable performance

suggesting they can be reused in future surveys

with similar objectives. The 0-2 scaling system

offers a low-threshold, intuitive approach while still

producing quantifiable data suitable for analysis.

The 3-3 provides more granularity and a bipolar

character which suits perceptual scales, but it could

be unstable when evaluating from an objective

approach. The selection of indicators for visual

features, and terms for the affective response survey

had an exploratory nature, and provided an overview

of their performance, being mostly accurate as the

values form the heatmaps can be easily identified in

the pictures. Some variability in the color selection

was notable, and a few scales that seemed less clear,

such as confusing-understandable, closed-open,

opaque-transparent, and hidden-exposed.

The limitations in the study include a low sample

size (n=22 and n=12) which compromises the

generalizability of the findings. All participants were

trained professionals and residents of Detmold.

These two factors could be taken as variables in

future studies (non-residents and non-professionals

in the construction industry).

The author extends sincere gratitude to BridgeRoot

Lda. (bridgeroot.uk) for their support during the

post-production of the photographs. Special thanks

to all participants who generously volunteered their

time and shared their insights. Additionally, special

thanks to the Human-Centered Façades team of TU

Delft for their insightful feedback in the early stages

of the study.

7. References

Axelsson O. Towards a psychology of photography:

dimensions underlying aesthetic appeal of photographs.

Percept Mot Skills. 2007 Oct;105(2):411-34. doi: 10.2466/

pms.105.2.411-434. PMID: 18065064.

Bahar, F., Santosa, H., and Ernawati, J. (2022) Visual Quality

of the Facade of Cultural Heritage Buildings in the Historic

Area of Jalan Semeru Malang City. Budapest International

Research and Critics Institute-Journal (BIRCI-Journal)

Volume 5. e-ISSN: 2615-3076 (Online), p-ISSN: 2615-1715

(Print)

Bourassa, SC. (1988), Toward a theory of landscape

aesthetics, Landscape and Urban Planning, Volume

15, Issues 3–4, 1988, ISSN 0169-2046, https://doi.

org/10.1016/0169-2046(88)90048-5.

Böhme, G. (2000), Acoustic Atmospheres; a Contribution

to the Study of Ecological Aesthetics. Journal of Acoustic

Ecology, Volume 1, Number 1, Spring 2000 https://

pdfcoffee.com/soundscape-the-journal-of-acousticecology-pdf-free.html

Botteldooren, D., De Coensel, B., Aletta, F., Kang, J. (2023).

Triangulation as a Tool in Soundscape Research. In:

30 ARTICLES


Schulte-Fortkamp, B., Fiebig, A., Sisneros, J.A., Popper, A.N.,

Fay, R.R. (eds) Soundscapes: Humans and Their Acoustic

Environment. Springer Handbook of Auditory Research,

vol 76. Springer, Cham. https://doi.org/10.1007/978-3-031-

22779-0_8

Brown, T. C., & Daniel, T. C. (1987). Context effects in

perceived environmental quality assessment: Scene

selection and landscape quality ratings. Journal of

Environmental Psychology, 7(3), 233–250. https://doi.

org/10.1016/S0272-

Daniel, T. C. (2001). Whither scenic beauty? Visual landscape

quality assessment in the 21st century. Landscape and

Urban Planning, 54(1-4), 267–281

Daniel, Terry C.; Boster, Ron S. 1976. Measuring landscape

esthetics: the scenic beauty estimation method. Res. Pap.

RM-RP-167. U.S. Department of Agriculture, Forest Service,

Rocky Mountain Range and Experiment Station. 66 p.

de la Fuente de Val, G., Atauri, JA., de Lucio, JV. (2006),

Relationship between landscape visual attributes and

spatial pattern indices: A test study in Mediterraneanclimate

landscapes, Landscape and Urban Planning,

Volume 77, Issue 4, ISSN 0169-2046, https://doi.

org/10.1016/j.landurbplan.2005.05.003.

Gobster, P., Ribe, RJ., Palmer, JF. (2019), Themes and

trends in visual assessment research: Introduction to the

Landscape and Urban Planning special collection on the

visual assessment of landscapes, Landscape and Urban

Planning, Volume 191, 103635, ISSN 0169-2046, https://doi.

org/10.1016/j.landurbplan.2019.103635

Kaplan, R., & Kaplan, S. (1989). The experience of nature:

A psychological perspective. Cambridge University Press.

Klein, Tillmann. (2013). Integral Façade Construction -

Towards a new product architecture for curtain walls.

Architecture and the Built Environment #03 https://books.

bk.tudelft.nl/press/catalog/book/44

Knaack, U., Klein, T., Bilow, M., Auer, T. (2007). Façades:

Principles of Construction. Birkhäuser Basel. https://doi.

org/10.1007/978-3-7643-8281-0

Lee, T. and Ng, E. (2024), Environ. Res.: Infrastruct. Sustain.

4 032001, DOI: 10.1088/2634-4505/ad78fc

Llorca-Bofí, J., Dreier, C., Heck, J., & Vorländer, M. (2022).

Urban Sound Auralization and Visualization Framework—

Case Study at IHTApark. Sustainability, 14(4), 2026. https://

doi.org/10.3390/su14042026

Lothian, A. (1999) Landscape and the Philosophy of

Aesthetics: Is Landscape Duality Inherent in the Landscape

or in the Eye of Beholder? Landscape and Urban Planning,

44, 177-198.

https://doi.org/10.1016/S0169-2046(99)00019-5

Lovell, J. Building Envelopes: an Integrated Strategy,

Princeton Architectural Press, 2010.

Martinez-Alcaraz, P., de la Barra, P., Andriotis, C.P., Wang,

Y., Luna-Navarro, A. (2025). Personalised Building Controls

Based on Individual Thermal Preferences for Energy

Efficiency and Thermal Comfort. In: Berardi, U. (eds)

Multiphysics and Multiscale Building Physics. IABP 2024.

Lecture Notes in Civil Engineering, vol 555. Springer,

Singapore. https://doi.org/10.1007/978-981-97-8317-5_31

Medeiros, A., Fernandes, C., Gonçalves, JF., Farinha-

Marques, P. (2023), Optimising a landscape visual

quality protocol. A Method for reducing respondent

fatigue and obtaining site-specific indicators, MethodsX,

Volume 11, ISSN 2215-0161, https://doi.org/10.1016/j.

mex.2023.102455.

Palmer, P. J. (1997). Teaching & Learning in

Community. About Campus, 2(5), 4-13. https://doi.

org/10.1177/108648229700200503 (Original work

published 1997)

Palmer, J.F. and Hoffman, R.E. (2001) Rating Reliability and

Representation Validity in Scenic Landscape Assessments.

Landscape and Urban Planning, 54, 149-161. http://dx.doi.

org/10.1016/S0169-2046(01)00133-5

Polat, AT, (2015) visual quality assessment in landscape

architecture. 19th International Academic Conference,

Florence ISBN Preliminary version, IISES

Prieto, A., & Oldenhave, M. (2021). What makes a façade

beautiful? Architects’ perspectives on the main aspects

that inform aesthetic preferences in façade design. Journal

of Facade Design and Engineering, 9(2), 21–46. https://doi.

org/10.7480/jfde.2021.2.5540

Scott, A. (2002). Assessing Public Perception of Landscape:

The LANDMAP experience. Landscape Research, 27(3),

271–295. https://doi.org/10.1080/01426390220149520

Scruton, R. (1979). The aesthetics of architecture. Princeton

University Press. ISBN: 9780691158334 https://press.

princeton.edu/books/paperback/9780691158334/theaesthetics-of-architecture?srsltid=AfmBOopGKwzjn7i890

CNWh4YPusLZezSejoNzqhdB602x98uwR-r8pPv

Stanford Encyclopedia of Philosophy (2022). The Concept

of the Aesthetic. https://plato.stanford.edu/entries/

aesthetic-concept/

Ulrich, RS. (1986), Human responses to vegetation and

landscapes, Landscape and Urban Planning, Volume

13, ISSN 0169-2046, https://doi.org/10.1016/0169-

2046(86)90005-8.

USDA, (1974). Special Collections, USDA National

Agricultural Library. Accessed May 2, 2025, https://www.

nal.usda.gov/exhibits/speccoll/items/show/1115

USDI, BLM (1980) Visual Simulation Techniques, US Gov

Print Off, Wash DC. https://www.scirp.org/reference/

referencespapers?referenceid=1879331

ARTICLES


31

Article

Hidden Steel Structures in Modern Sacred Architecture: Integrating

Academic Opportunities with Research

Längsbinderkirchen und versteckte Stahlkonstruktionen im Sakralbau der Hochmoderne. Grundlagenforschung zur Erfassung und zu denkmalpflegerischen Strategien.“

(DFG-Projectniumber: 525823438 - URL: https://gepris.dfg.de/gepris/projekt/525823438)

Najmeh Najafpour 1 , Prof. Dr.-Ing. Uta Pottgiesser 1,2

1. Detmold School of Design, TH OWL, University of Applied Sciences and Arts, Emilienstraße 45, 32756 Detmold, Germany

2. Heritage & Architecture, Department of Architectural Engineering and Technology, Faculty of Architecture and the Built Environment, TU Delft, Julianalaan,

134, 2628 BL Delft, The Netherlands

Abstract

This article reflects on modern sacred architecture that is investigated in the DFG research project dealing with

longitudinal hidden steel truss structures and their architectural, structural, and conservation challenges1.

Constructed during the inter-war, as well as in the post-war period, in German-speaking countries this innovative

way of construction facilitated large spans and column-free interiors. The project is structured into three

phases: The first phase, ‘Recording and Classification’, involves archival research, field surveys, and structural

documentation to establish a comprehensive database. The second phase, ‘Recognition and Evaluation’,

assesses architectural relevance, structural integrity, and monument conservation value, leading to the

development of standardized heritage assessment criteria. The third phase, ‘Preservation and Development’,

formulates conservation strategies and adaptive reuse proposals, ensuring these structures remain both

culturally significant and functionally viable. However, the churches and their constructions have remained

largely undocumented. The motivation behind the research is three-folded: Firstly, lack of knowledge about

the construction methods. Secondly, lack of protection for some of the churches built with this innovation.

And finally, current pressure to convert some of them into new purposes. The churches share this fate with

many hidden steel structures that were also used for larger cultural and commercial buildings. The project

and this article want to bring these structures back to light and to the attention of experts and the public.

By integrating architectural history, civil engineering, and material science, the project and its linked student

works contributes to the broader discourse on “Cultural Heritage Construction (Kulturerbe Konstruktion)” and

is addressing both academic research and teaching, and practical conservation challenges.

Keywords: longitudinal truss churches, hidden steel structures, sacred architecture, monument conservation

and preservation, adaptive reuse conservation, adaptive reuse, sustainability in architecture

1. Introduction

The study of longitudinal hidden steel truss

structures in modern sacred architecture is an area

that has received limited scholarly attention despite

its architectural and technological significance.

Between 1928 and 1938, as well as in the post-war

period, numerous religious buildings, predominantly

Catholic but also Protestant, were constructed

in German-speaking countries utilizing steel as a

primary structural material (Fissabre et al., 2022).

A defining characteristic of these buildings is the

longitudinal truss, which creates large spans and

column-free interiors, allowing open and flexible

worship spaces. The steel skeletons were concealed

behind cladding or plaster, making this innovation

largely unnoticed.

Figure 1. Spanning a column-free basilica, the

rationale behind longitudinal truss structure

(Hegemann, 1929, pp. XII, 180).

32 ARTICLES


This fact aligns with general engineered constructions

where structural components remain hidden

within different architectural forms, as examined

in contemporary studies on Hidden Structures in

Germany (Lorenz & Gielen, 2023).

Despite being sacred and thus the need to be

spiritual, churches also serve functional needs,

balancing functionality with spiritual meaning. A

space that is not just a physical structure, but also

a metaphor for the divine. A space that represents

both the earthly and eternal realms (Nollert et al.,

2011). Sacred architecture, therefore, is not just

defined by its religious function. Sacred spaces

are typically marked by thresholds or boundaries,

symbolizing the transition from the mundane to

the sacred. A physical and symbolic space where

the divine is present, and where individuals can

experience a connection to it (Büchse et al., 2012).

Like other countries Germany faced significant

changes in the architectural style and functions

in the interwar period which resulted in the birth

of modern construction typologies as well. In

the same manner, in the first decades of the 20th

century, modern sacred architecture underwent a

fundamental transformation, moving away from the

monumental designs of the Gothic Revival or Eclectic

Historicism towards simpler, more functional forms

(Pursell, 2003). The demand to rebuild the destroyed

churches of WWI and WWII further shaped a new

church architecture. Despite these advancements,

the period up to the WWII represents an initial phase

rather than a culmination of church architecture

(Weyres & Otto, 1959). The modern church of the

20th century intended to integrate into daily life

rather than standing apart (Nagel & Linke, 1968).

The integration of steel trusses in sacred architecture

was initially met with resistance from church

institutions and some construction authorities, who

viewed the industrial aesthetic as inappropriate for

these settings. Nonetheless, the use of steel enabled

new spatial configurations. Despite their innovative

construction, many of these churches remain underdocumented

in architectural history and with regard

to preservation efforts. Contemporary publications

often omitted references to the steel construction,

contributing to a lack of awareness regarding their

structural methodologies. The identification and

analysis of these structures are therefore crucial for

understanding their role in the evolution of modern

materials and constructions in modern sacred

architecture (Fissabre et al., 2022).

The research project is funded within the Priority

Program (SPP) “Cultural Heritage Construction” (SPP,

2024) by the German Research Foundation (DFG). It

is conducted in collaboration with multiple academic

partners from FH Aachen, TU Braunschweig, and

TH OWL, led by Prof. Dr.-Ing. Anke Fissabre (FH

Aachen), Prof. Dr.-Ing. Evelin Rottke (FH Aachen),

Prof. Dr. sc. techn. Klaus Thiele (TU Braunschweig),

and Prof. Dr.-Ing. Uta Pottgiesser (TH OWL), bringing

together expertise from different disciplines. This

research aims to systematically document and

analyse the architectural and structural principles

of these churches. By examining historical records,

architectural plans, and conducting structural

investigations and digital documentation, the

study seeks to clarify the technical and cultural

significance of these buildings. Additionally,

it explores the interplay between structural

engineering and ecclesiastical design, shedding light

on the contributions of architects and engineers in

shaping sacred spaces during the early and mid-20th

century. Another factor is the increasing pressure

of adaptive reuse due to deconsecration (Strack,

2024). Subsequently a thorough understanding of

their construction, is essential for informed heritage

conservation.

Figure 2. Construction process of the steel truss

structure of the St. Dreifaltigkeit church in Herne

in 1931 (Pfarrgemeinde St. Dreifaltigkeit Herne-

Holthausen, 1983, p. 35)

2. Methodology

The research employs a multidisciplinary

methodology and is structured into three

interrelated phases:

(1) Recording and Classification, which involves

comprehensive archival research and field surveys

to identify and document these structures;

(2) Recognition and Evaluation, where structural

and historical analyses are conducted to assess

the architectural and cultural significance of these

buildings, leading to the development of heritage

evaluation frameworks; and

(3) Preservation and Development, which formulates

conservation strategies and adaptive reuse

proposals to ensure the long-term sustainability of

these structures.

ARTICLES


33

collection process to systematically document and

analyse these buildings.

The final phase focuses on developing strategies for

the sustainable conservation and adaptive reuse of

these buildings. By analysing typical damage patterns

and structural vulnerabilities, targeted conservation

measures are proposed. These recommendations

include both preventive maintenance strategies and

active restoration techniques tailored to the unique

construction materials and methods used in these

churches.

Figure 3. Map of sacred building identified in the

region (DFG-Project, 2024).

The first phase of the study involves an extensive

documentation and classification of modern sacred

buildings which are supposed to be constructed

with longitudinal hidden steel truss structures.

Through systematic field surveys and architectural

investigations, key details regarding construction

techniques, material compositions, and spatial

configurations are documented. To achieve

precise documentation, advanced digital survey

methods such as 3D laser scanning, UAV-based

photogrammetry, and thermographic imaging

are utilized. Structural investigations focus on

determining the load-bearing capacity, material

degradation, and hidden connections that influence

the overall stability of these buildings. Additionally,

connections between these buildings and the

steel industry are explored to contextualize their

construction within broader economic and industrial

trends.

Potential interventions such as interior modifications,

structural reinforcements, and facade restorations

can be evaluated to ensure compatibility with both

historical authenticity and contemporary usage.

Addressing viable approaches for repurposing these

buildings in response to the needs of society and

local communities ensures that their historical and

architectural significance is preserved while allowing

for contemporary functionality.

Figure 5. Roof detail (Herkommer, 1931, p. 184).

3. Integrating Academic

Opportunities with the Research

Figure 4. Detail of wall composition (Herkommer,

1929, p. XXI).

In the second analytical phase the cultural,

architectural, and technological significance of the

identified buildings are critically assessed. A primary

goal is to establish standardized criteria for assessing

the heritage values and for developing a preservation

framework. to facilitate decision-making for

heritage authorities. A key aspect of this phase is a

comparative analysis, where the recorded structures

are assessed against similar steel-structured

buildings within sacred and secular architecture. The

project employs a structured and multi-layered data

University-led research plays a crucial role in

advancing the understanding of architectural

heritage and structural engineering. Within the

framework of the DFG research project, student

research and study projects can contribute to

this discourse by exploring structural analysis,

material performance, and conservation strategies.

These projects exemplify how academic teaching

and university-led research interconnect with

the ongoing research project, allowing students

to engage with the current investigations while

reinforcing the project’s overarching objectives. The

following sections provide an overview of five? theses

that stem from this collaborative research effort.

34 ARTICLES


3.1. Fire and Corrosion Protection

Strategies in High-Modernist Steel

Churches

The master’s thesis (Heidelin, 2025) focuses on the

fire and corrosion protection measures applied to

steel-framed churches from the early 20th century.

The thesis examines historical fireproofing and anticorrosion

techniques, assessing their effectiveness

over time. Through case studies, including St.

Willibrord in Kleve-Kellen (1929) and Heilig-Geist

in Frankfurt-Riederwald, the thesis evaluates how

early steel churches addressed durability challenges

and what implications these methods hold for

contemporary conservation efforts. The research

contributes to the broader discussion on adaptive

reuse strategies, ensuring structural safety while

preserving the authenticity of high-modernist

sacred buildings.

3.2. Façade Renovation Strategies for

Modern Sacred Architecture

The master’s thesis (Najafpour, 2025) focuses on the

third phase “Maintaining and Developing” of the DGF

research project and extend it by focusing on façade

renovation strategies for churches constructed

between the 1920s and 1940s, emphasizing

energy efficiency improvements while respecting

architectural integrity. It explores thermal retrofitting

and the impact of façade modifications on structural

behaviour of the case study, St. Dreifaltigkeit church

in Herne. Additionally, the research integrates energy

simulation tools to propose renovation solutions that

balance historical conservation with contemporary

sustainability standards. Adaptive reuse scenarios

for historical buildings are further studied to present

a compatible solution for the case studies. Finally,

presenting a comprehensive conclusion to address

various aspects influential in the final outcome.

Figure 6. CO2 reduction of façade renovation

(Najafpour, 2025).

3.3. Investigation of the Potential of

the Geo-Radar Method in Building

Diagnostics

The master‘s thesis (Koch, 2024) examines the

potential of the geo-radar method in building

diagnostics using the example of the church ‘Zu den

heiligen Schutzengeln’ in Schaffhausen, a so-called

‘steel church’ from the interwar period. The aim is

to evaluate the suitability of geo-radar, partly in

combination with endoscopy, for the non-destructive

localization of the installed steel construction

elements in the masonry. To this end, laboratory

tests are carried out, the results of which are

compared with field data and compared with existing

data sets from earlier building investigations. At the

same time, a historical classification of the church

is carried out on the basis of archival research. The

work contributes to the further development of lowdestruction

investigation methods and evaluates

their significance for analysing historical sacred

buildings in accordance with the requirements of

listed buildings.

3.4. Structural Analysis of the St.

Dreifaltigkeit church in Herne-

Holthausen

The master’s thesis (Ringel, 2025) investigates

the structural composition and analysis of the

St. Dreifaltigkeitskirche in Herne-Holthausen, a

longitudinal truss church built in 1931. Given the

economic constraints of the interwar period, steel

emerged as a viable material, enabling large sans

with high load-bearing capacity. However, due

to its industrial connotation, steel structures in

ecclesiastical architecture were often concealed

behind mineral-based cladding. This thesis aims

to identify hidden steel elements, assess their

structural integrity, and reconstruct the original

load-bearing system through on-site measurements

and archival research. By documenting the historical

construction methods and analyzing material

properties, the study enhances the understanding

of structural vulnerabilities and conservation needs

for similar steel-frame churches.

3.5. Transformation and Adaptive

Reuse of the St. Dreifaltigkeit Church

in Herne

A forthcoming master‘s thesis will focus on the

adaptive reuse of the St. Dreifaltigkeit Church

in Herne, exploring strategies for repurposing

the space while maintaining its architectural and

cultural significance. The research will examine

functional transformation possibilities, addressing

the challenges of integrating new uses within a

historically and structurally significant sacred

building. Through case study analysis and design

proposals, the thesis aims to contribute to the

discourse on sustainable preservation and adaptive

reuse of modernist churches.

Together, these researches illustrate how

university-based academic researches foster

student engagement in heritage conservation and

structural engineering research, reinforcing the

role of interdisciplinary collaboration within the

research framework. The integration of such largescale

research projects into academic curricula

and university coursework not only enhances

students‘ understanding of complex architectural

ARTICLES


35

and structural challenges but also encourages

active participation in ongoing scientific inquiries. By

exposing students to real-world heritage conservation

and engineering methodologies, this approach

bridges the gap between theoretical knowledge

and applied research, creating a deeper academic

and professional commitment. Strengthening these

connections between funded research, university

education, and student involvement ensures that

future scholars are well-equipped to continue

investigations in architectural heritage, material

science, and structural preservation, ultimately

contributing to the advancement of modern

conservation strategies.

4. Results

4.1. Raising Awareness

A significant aspect of this research should be its

contribution to the global architectural heritage

conversation. By integrating the findings into

the collection of DOCOMOMO International, the

project will ensure that this knowledge will reach

an international audience. This allows scholars,

conservationists, and policymakers to access critical

insights into hidden steel construction in modern

sacred buildings, enabling comparative research and

collaborative heritage initiatives.

A key contribution of the study the envisioned openaccess

repository could foster ongoing international

collaboration. The repository serves as an

educational resource, allowing future researchers,

conservationists, and architects to build upon the

documented findings, and ideally add and extend

specific knowledge in the future, also allowing for

widespread dissemination and further research

opportunities.

4.2. Historical Analyses and

Conservation

Beyond architectural innovations, this research

may serve as a stepping stone in examining the

industrial and economic factors that influenced the

adoption of steel structures in sacred architecture.

The connections between architects, steel

manufacturers, and civil engineers could be further

explored to provide insights into the collaborative

efforts that facilitated these constructions. Similar

structural developments were documented in

Berlin, where innovative engineering solutions

influenced modernist constructions, including

sacred architecture (Staroste, May & Lorenz, 2020).

A significant aspect of this research is the insight into

the adaptation of industrial construction techniques

into sacred architecture, revealing how methods

traditionally employed in non-secular construction

influenced church design. Through structural

modelling and material analysis, the study explores

the extent to which early prefabrication and serial

production techniques may have played a role in

these buildings, if applicable, particularly in optimizing

construction efficiency and material usage. These

findings contribute to a broader understanding

of how architecture of the modern movement

integrated industrial advancements into nonindustrial

buildings and religious spaces, ultimately

shaping new forms of sacred environments.

Additionally, archival studies may shed light on lesserknown

pioneers and early experiments with these

techniques, contributing to a deeper understanding

of their development. This contextualization

is essential for uncovering the economic and

technological motivations behind the integration of

steel-based construction in religious architecture.

Furthermore, this research contributes to a

monument conservation assessment of these

buildings, which will further contribute to a broader

policy framework for historic preservation of hidden

steel constructions.

5. Limitations

Figure 7. Screenshot of Docomomo.Architectuul

(Architectuul, n.d.)

The project faces several challenges that impact

data collection, structural analysis, and conservation

planning. A primary limitation is the incomplete

historical documentation of these churches,

as many archival records lack details on their

structural composition, material specifications, or

modifications over time. This absence of systematic

archival data complicates is making it difficult to

verify their original construction methods, material

properties, and structural behaviour. Additionally,

this gap in documentation presents challenges

for non-destructive testing methods, which rely

on prior knowledge of material configurations

and often produce inconclusive results when key

historical details are missing. The necessity of cross-

36 ARTICLES


referencing fragmented historical sources and

waiting for responses from monument authorities

and archival institutions further extends the

research timeline, requiring continuous validation

and iterative reassessment.

Another significant limitation is the disparity in

research timelines and data availability. The phased

nature of the project means that researchers working

on specific aspects—such as student theses—

often rely on incomplete data, leading to necessary

assumptions that may later prove inaccurate

once additional archival or structural information

becomes available. The delayed accessibility of

critical data means that certain analyses may need

to be revisited after findings from other parts of

the research emerge. This workflow can affect the

coherence of findings in earlier research stages,

requiring constant revision and integration of newly

acquired information. As the project progresses,

refining data-sharing mechanisms and synchronizing

research efforts will be crucial to mitigating these

limitations and ensuring greater accuracy and

consistency across all phases.

A critical factor that will impact the project is the

practical implementation of conservation and

adaptive reuse strategies in later phases. While the

research itself focuses on documenting, analysing,

and proposing solutions, the actual execution of

interventions in real-world scenarios will encounter

external constraints that extend beyond the

research framework. The preservation and potential

repurposing of these churches depend not only on

their structural and material characteristics but also

on regulatory, social, and cultural considerations that

influence decision-making. These factors shape the

feasibility and scope of adaptive reuse, introducing

additional challenges that must be accounted for in

the final conservation strategies.

A major challenge is the strong cultural and emotional

attachment that communities have to sacred

buildings. These structures are deeply connected

to collective memory, social identity, and cultural

heritage, making any intervention—particularly

adaptive reuse—a sensitive and complex process. In

the third phase, which focuses on maintenance and

development, these considerations pose significant

challenges, as adaptive reuse strategies must

carefully balance modern functionality with historical

and cultural significance. The integration of new uses

into these spaces requires thorough community

engagement and contextual analysis to ensure that

transformations align with societal expectations and

heritage values, not to mention financial feasibility.

Additionally, many of these churches are listed

buildings, subject to strict heritage regulations

that impose constraints on modifications and

interventions. The challenge lies in finding feasible

solutions that respect conservation guidelines

while enabling these structures to remain usable

and relevant in contemporary settings. Historically

significant buildings with architectural and cultural

value often require a delicate negotiation between

preserving authenticity and accommodating new

functions, ensuring that adaptive reuse does not

compromise their historical integrity. The third phase

of the project will need to address these challenges

by developing carefully considered strategies that

reconcile heritage conservation principles with the

evolving needs of society and urban development.

6. Conclusions

The complexity of the subject, combined with the

limited availability of historical records, makes

progress gradual, requiring extensive archival

inquiries, field surveys, and technical verifications.

Since multiple academic institutions are working

collaboratively, the project benefits from an

interdisciplinary approach, yet it also requires careful

coordination to synthesize findings across different

research strands. The time-consuming nature

of data validation, particularly regarding church

records, structural assessments, and material

properties, highlights the necessity of continuous

refinement of methodologies and adaptation to

emerging challenges.

Despite these challenges, the project lays the

groundwork for an understanding of these structures

and buildings associated and also provides

the base for future research and conservation

efforts, establishing a systematic framework for

documenting, assessing, and preserving these

underrepresented sacred structures. While

many aspects remain under investigation, the

ongoing inquiries will ultimately provide a more

comprehensive understanding of these structures,

ensuring that they receive the recognition and

preservation strategies they require within heritage

and conservation discourse.

7. References

Architectuul. (n.d.). Architecture In Danger. Architectuul.

https://architectuul.com/digest/architecture-in-danger

Büchse, A., Fendrich, H., Reichling, P., & Zahner, W.

(Eds.). (2012). Kirchen - Nutzung und Umnutzung:

Kulturgeschichtliche, theologische und praktische

Reflexionen. Aschendorff.

DFG-Project (2024). Längsbinderkirchen und versteckte

Stahlkonstruktionen im Sakralbau der Hochmoderne.

[Unpublished project documentation]. FH Aachen, TU

Braunschweig, TH OWL.

GEPRIS (2024). Deutsche Forschungsgemeinschaft (DFG)

– Projektnummer 525823438. Detailseite Projekt. https://

gepris.dfg.de/gepris/t/525823438?context=projekt&task=

showDetail&id=525823438&

Hegemann, W. (1929). Hans Herkommers neue Kirchen.

Wasmuths Monatshefte für Baukunst und Städtebau, 13,

175-183.

Heidelin, L. (2024). Stahlkirchen der Hochmoderne –

Eine Konstruktionsanalyse zu Strategien des Brand- und

ARTICLES


37

Korrosionsschutzes an Stahlhochbauten der ersten

Hälfte des 20. Jahrhunderts. Technische Universität

Braunschweig, Institut für Bauwerkserhaltung und

Tragwerk.

Herkommer, H. (1931). Katholische Kirchen in Ratingen und

Schneidmühl. Zentralblatt der Bauverwaltung, 51(12), 181-

186.

Koch, M. (2024). Untersuchung zu Potentialen der

Georadarmethode in der Bauwerksdiagnostik –

Ermittlungen am Fallbeispiel der Kirche „Zu den heiligen

Schutzengeln“ in Schaffhausen [Master’s thesis, Technische

Universität Braunschweig].

Lorenz, W., & Gielen, M., with 3D IT. (2023). Hidden

structures: The art of engineering. Retrieved from https://

hidden-structures.info/en/map/

Nagel, S., & Linke, S. (Eds.). (1968). Kirchliches Bauen.

Najafpour, N. (2025). Energy efficiency and environmental

impact in façade renovation strategies for modern

sacred architecture: An application on Dreifaltigkeit

Church in Herne [Master’s thesis, Technische Hochschule

Ostwestfalen-Lippe].

Nollert, A., Volkenandt, M., Gollan, R.-M., & Frick, E. (Eds.).

(2011). Kirchenbauten in der Gegenwart: Architektur

zwischen Sakralität und sozialer Wirklichkeit. Pustet, F.

Pfarrgemeinde St. Dreifaltigkeit Herne-Holthausen. (1983).

Festschrift der Pfarrgemeinde St. Dreifaltigkeit Herne-

Holthausen anlässlich des 75-jährigen Bestehens der

Pfarrgemeinde. Pfarrgemeinde St. Dreifaltigkeit.

Pursell, T. (2003). “The Burial of the Future”: Modernist

architecture and the cremationist movement in Wilhelmine

Germany. Mortality, 8, 233–2504. https://doi.org/10.1080/1

3576270310001599795

Ringel, F. (2025). St. Dreifaltigkeits-Kirche in Herne-

Holthausen – Untersuchung und Analyse des Tragwerks

einer Längsbinderkirche in Stahlskelettbauweise von

1931. Technische Universität Braunschweig, Institut für

Bauwerkserhaltung und Tragwerk.

SPP 2024 Schwerpunktprogramm „Kutlurerbe

Konstruktion“,

https://kulturerbe-konstruktion.

de/?lang=en

Staroste, H., May, R. & Lorenz, W. with the participation

of Ines Prokop (2020). Ingenieurbauführer Berlin. Michael

Imhof Verlag Petersberg.

Strack, C. (2024). Germany: Catholic churches are

demolished or repurposed. Dw.Com.

Weyres, W., & Otto, B. (1959). Kirchen. Handbuch fuer den

Kirchenbau. Verlag Georg D. W. Callwey Muenchen.

38 ARTICLES


Circular Facade Design: The Importance of end of life scenarios to

reduce environmental Impact

Article

Abdelrahman Badr 1

Supervisors: Prof. Dipl.-Ing. Daniel Arztmann 1 , Dipl.-Ing. Florian Starz², MSc Carmen Herrmann²


2. Werner Sobek AG, Albstraße 14, 70597 Stuttgart, Germany

Abstract

This study explores the transition from a linear to a circular economy in the building and construction industry,

focusing on the environmental impacts of façade systems in office buildings. The linear „Take-Make-Dispose“

model contributes significantly to resource consumption, waste generation, and CO2 emissions, with the

construction sector responsible for 35% of global waste. The EU‘s Circular Economy Action Plan emphasizes

designing products to minimize waste and retain resources, highlighting the importance of end-of-life (EoL)

considerations in construction. Life Cycle Assessment (LCA) is employed to evaluate the environmental impacts

of design decisions, particularly for stick curtain wall systems, which are widely used in office buildings. The

research adopts a mixed methodology, combining literature review and design process analysis, focusing

on frame materials (aluminum, steel, wood) and glass options. Three EoL scenarios—reuse, recycling, and

demolition—are assessed to determine their impact on embodied carbon. The study is limited to office buildings

in Germany, with a case study in Stuttgart, due to the prevalence of stick systems in such structures. Preliminary

findings indicate that reuse scenarios generally have the lowest environmental impact, though outcomes vary

based on material combinations. By systematically analyzing EoL scenarios, this research provides a framework

for optimizing façade designs to enhance sustainability, reduce waste, and promote circularity in real-world

construction projects.

Keywords: circularity, end of life scenarios, embodied carbon, stick systems

1. Introduction

For years, products were developed in a linear

economy characterized by a „Take-Make-Dispose“

approach, contributing to the so-called „Throwaway

Society.“ This system has significantly impacted

the environment, with 50% of global greenhouse

gas emissions resulting from the extraction and

processing of natural resources. Despite the 2015

Paris Agreement, where 195 countries committed

to limiting global temperature rise to 1.5°C,

recent research indicates that current efforts are

insufficient, with projections suggesting warming

of 2.5-2.9°C unless emissions fall by 28%-42% by

2030 (“Emissions Gap Report 2023: Broken Record,”

2023). A key strategy to achieve this is transitioning

from a linear to a circular economy, which promotes

material reuse and closed-loop systems to maximize

resource efficiency. Circular economy modeling has

demonstrated a potential 50% reduction in natural

resource consumption by 2050 compared to 2018,

with CO2e emissions from the built environment

expected to decrease by 38% by 2050 and up to

56% beyond that (Stahel and MacArthur, 2019).

The End-of-Life (EoL) phase plays a crucial role in

this transition by reducing energy consumption

and minimizing environmental impacts (“Circular

Economy Action Plan - European Commission,”

2020). This thesis focuses on EoL scenarios in

façade design, particularly addressing stick systems,

to promote material reuse and recycling over

demolition. By integrating circular strategies early

in the design process, architects can contribute

to a more sustainable built environment. Reusing

building materials alone has the potential to cut CO2e

emissions by 0.3 billion tons annually, significantly

reducing reliance on new primary materials while

fostering climate-conscious construction practices.

ARTICLES


39

1.2. Scope and Research Question

Figure 1. Scope, objective and research question.

1.1. Problem Statement

The built environment which accounts for

approximately 42% of carbon emissions where vast

number of raw materials is produced, and a lot of

waste is generated. Reflecting this in Germany,

60% of waste comes from the construction and

demolition industry (including road construction)

(Ministry,2020). So, shifting to circularity is important

as it allows materials to be in continuous use of

resources through recycling and reusing. To achieve

that the end-of-life phase needs to be considered

as it forms the link between the linear economy

and the circular economy. Focusing on the End-of-

Life (eol) phase, evaluative design aids like Life Cycle

Assessment (LCA) provide metrics and methods

to assess the environmental impacts of different

design choices. However, previous research has

shown that lcas, particularly those applied to

façades, often oversimplify eol scenarios. This is

typically due to the assumption of a predominant

landfill scenario, neglecting alternative possibilities

such as reuse or recycling. While lcas aim to evaluate

the environmental impacts of buildings across their

entire life cycle, the eol phase is often not given

sufficient attention. These gaps in information and

oversimplifications during the lca process are critical

to address, as they directly impact the ability of

planners to make informed decisions in the design

phase. A more comprehensive understanding of

material properties, production processes, and endof-life

scenarios is essential to ensure that design

choices align with sustainability goals and minimize

environmental impacts. Incorporating different eol

considerations at the planning phase is a key Factor

promoting circularity. As systems are considered

during the planning phase on how they would

be treated at the end of life of the building phase.

Designers can contribute to this flow of materials

and minimize waste.

This Thesis “Circular Façade design” will evaluate

stick curtain wall systems considering various

end of life scenarios. The research focuses on the

different materiality of the frame (mullion, transom)

and the insulated glazing built up through a life cycle

assessment approach. Other Façade components

such as cover cap, brackets and Aluminum sheet are

also considered. While insulation and gaskets are

considered but having only one scenario at the end

of life. This research will be limited to office buildings

as a type of building that is widely used in Germany.

As the extensive use of stick systems in office

buildings, with their large, glazed surfaces, presents

an opportunity to explore more sustainable façade

solutions. So, the Research through design will be

done to compare the designs of an office building

designed in Stuttgart Germany.Additionally, the

developed designs align with the with the clear

regulation parameters given to the installation

of glass elements in areas where there is a risk of

falling. This area varies but the case study will focus

on Category A and Category C2 according to the

German, the DIN 18008, part 4.

2. Literature Review

The research project follows a mixed methodology

which consists of two parts literature review and

research through design. The literature review will

gain insights about circularity, life cycle assessment

highlighting the end of life in each topic and stick

curtain wall systems focusing on the rethinking the

materiality of the profiles and glass as those are the

main variables for the design phase.

2.1. Circularity

Figure 2. Topics Reviewed.

The construction sector is a major contributor to

waste and emissions, with Germany generating

209 million tons of construction and demolition

waste annually, making up 52% of the country‘s

total waste. Embodied carbon, is mainly through

material extraction, manufacturing, transportation,

and disposal, it is particularly concerning as it cannot

be reduced over time like operational carbon. Key

materials such as cement, iron, steel, and aluminum

contribute 15% to global emissions, while building

40

ARTICLES


façades alone account for up to 16% of a structure’s

embodied carbon (“Why the Built Environment –

Architecture 2030,” n.d.). To mitigate this impact,

circular economy strategies focus on reducing carbonintensive

materials and optimizing façade profile

selection and glass composition. Material choices,

including thickness and type of glass, significantly

affect CO2 emissions. Additionally, end-of-life (EOL)

strategies—remanufacturing, reuse, and recycling—

are essential for minimizing environmental impact.

Studies show that EOL decisions in construction are

driven by environmental benefits (60%), economic

costs (27%), technical feasibility (9%), and social

considerations (4%) (Berg, Hulsbeek, and Voordijk,

2023).

2.2. Life Cycle Assessment

The Life Cycle Assessment (LCA) process was first

reviewed, covering key aspects from defining the

goal and scope to exploring Environmental Product

Declarations (EPDs) and essential LCA terms. A

particular focus was placed on the end-of-life (EOL)

stage within the LCA framework, examining where

and how it occurs in construction. Assessing the

EOL phase is crucial for sustainable practices, as

circular economy policies emphasize regeneration,

refurbishment, and material reuse. According to EN

15978, this phase is classified as ‚Module C,‘ beginning

with demolition or deconstruction, where materials

are either recovered for reuse or disposed of as

waste. Fig. 3 illustrates a circular design approach that

considers reuse at both the building and component

levels. Decisions made in Module C can lead to either

disposal or, when applying circular strategies under

Module D, contribute to future material cycles while

reducing environmental emissions (Ciroth & Hamed,

2024). LCA methodologies vary due to differences in

functional units, system boundaries, data collection,

and assumptions, complicating environmental

impact assessments. Additionally, uncertainty in

EOL data presents challenges, as assumptions must

be made about future material treatment methods,

recycling efficiencies, and transportation distances.

Figure 3. Circular LCA model design, (De Wolf,

Hoxha, and Fivet 2020).

Improved EOL modeling in LCA can enhance waste

management strategies and sustainable construction

practices. To address these complexities, relevant

studies were reviewed to establish effective

approaches. The article „Life Cycle Assessment of

Curtain Wall Facades: A Screening Study on End-of-

Life Scenarios“ (Cheong et al., 2024) examines the

environmental impact of different EOL strategies

for curtain wall façades. Using LCA methodology,

it compares recycling, reuse, and landfill scenarios

for aluminum profiles, glass panels, and other

façade components. The case study adopts the

assumptions from this study to ensure consistency

in evaluating EOL scenarios, including recycling

efficiencies and material treatment processes. Global

warming potential (GWP) and other environmental

indicators were used to assess impacts. The findings

highlight that material reuse significantly reduces

embodied carbon compared to recycling or disposal.

Additionally, the study emphasizes the importance

of component lifespan and design for disassembly in

making reuse strategies more feasible and effective.

2.3. Stick System Curtain wall

This part involves reviewing curtain wall, especially

stick systems. As it will be the system used in the

further in the case study. Later, focusing specifically

on the materially of the frame and the Glass as

they have a huge contribution in facades. (“Carbon

Footprint of Façades: Significance of Glass”,2022).

The glass is often an important part of the carbon

footprint. For the curtain walls, mullions and

transoms also account for a very large share of the

carbon footprint. For this study different mullions

and transoms will be evaluated also different types of

glazing built up. Other components such as gaskets

polyamide, EPDM and insulation are considered in

the case study but aren’t part of the literature review.

For material profiles Aluminum can easily be recycled;

components often retain high quality post-use,

though reuse can be difficult without standardization

and maintained. For Steel like Aluminum with slightly

different as it is easily separated and recycled,

and closed-loop systems are achievable, retaining

strength and quality. While timber has a shorter

life expectancy and lower fire resistance compared

to metals, its overall sustainability is bolstered by

its renewability and ability to be downcycled. The

type of glass significantly influences its potential for

reuse and recycling. Table 1 outlines the processes

suitable for remanufacturing glass and the end-oflife

possibilities for different glass types. Annealed

(float) glass panes are well-suited for reuse, as they

can be cut and further processed. In contrast, softcoated

glass is typically recycled, while printed

(enamelled) glass has limited recycling options due

to its coloration. Thermally prestressed glass cannot

be cut or edge-processed but can be reused in

the same format as laminated or insulating glass.

Laminated glass is difficult to reassemble into

insulating glass units (IGUs) and is often recycled in

an open-loop process, where its cullet is classified

as Class B or Class C and downcycled into insulation

ARTICLES


41

or aggregate for road paint. Additionally, glass with

a high post-consumer cullet content is generally

produced as mid-iron or normal float glass rather

than low-iron glass. This underscores the importance

of understanding glass types when evaluating reuse

and recycling opportunities in building projects

(“Reuse, Remanufacturing, Recycling: The Case of

Glass for Buildings,” n.d.)

Table 1 Glass types of comparison and end of life

possibilities, (“Reuse, Remanufacturing, Recycling:

The Case of Glass for Buildings” n.d.)z

3. Case Study-Façade of an Office

unit

3.1. Presentation of Case Study

The two proposed designs are Cat A and C2 design

where each module has a width of 1.35m and height

of 3.5m. Each module has an infill opaque panel of

0.6m and the glass height is 2.9 m The brackets are

assesned where the top point is movable and the

bottom point is Fixed. The main difference between

the two designs is that C2 design has an extra

transom at a height of 1 meter for safty. Separating

the upper glazing from the bottom glazing. Making

Cat C2 more heaiver in terms of weight. The key goal

is to see the impacts of different end of life scenarios

to the embodied carbon of different façade design.

Through comparison of different designs of curtain

wall using a life cycle assessment framework, the

two driven designs align with the Clear regulation

given to the installation of glass elements in areas

where there is a risk of falling. This area varies but

the following case study will focus on Category A

and Category C2 according to the German, the

DIN 18008, part 4. Also, the study assumes that C2

glazing is the same in the upper and lower pane

according to the code it is allowed. But in practical

use often laminated glass in used in the lower

pane. Nevertheless, three glass built up options are

designed having the same U-value and g-value of the

IGU. Only triple glazing units are considered in this

case study as double glazing is not used generally

built for office buildings in Germany. But the same

methodology can be applied using double glazing

but depending on the location where the façade is

planned the u-value and g-value shall be calculated

again. While for the Frame materiality three types

of materiality will be evaluated Aluminum as a base

design, Steel and wood.

3.2. Methodology

Figure 4. Category A and Category C2 proposed

facade design.

The building set up is done to give the first

introduction of the case study and to start

investigating the façade design in depth. The

location is in Stuttgart and the study considered a

unit which is neither first nor last floor. The Facade

Form Factor (FFF) is used to express the ratio of the

Facade Surface Area (FSA) to the gross internal floor

area (GIA). For the case study a form factor of 1 is

considered. While the Floor-to-Floor height is 3.5m

used as a reference for the design of the Façade and

is used in further calculations. And the wind load

considered is 1.3kn/m2 the study period of 60 years

is used as it is the common life service of Buildings.

Figure 5. Case Study methodology.

The methodology of the case study is a simple

comparison between the two façades. It is done

using different design parameters. The design

variables are Materiality of the frame and glass and

end of life scenarios. Then a calculation of embodied

carbon of each façade will be done which follows

the Life cycle framework. The calculation utilized

in this assessment follows the method of the

Centre for Window & Cladding Technology (CWCT)

standardized methodology for the embodied

carbon assessment of facades and cladding. The

calculation of each phase while considering phase

D represents the benefits of reusing and recycling.

42

ARTICLES


Then the results will be comparing first the end of

life scenarios Reuse, recycle and demolish to find the

difference between then concerning the emissions

and the second comparison is to determine which

Variants has the least embodied carbon and the

most embodied carbon. The Assessment focus on

highlighting the end of life and beyond end of life

so the assessment includes the following life cycle

modules:

• Product stage [A1 – A3]

• Construction process stage [A4]

• Replacement stage [B4]

• End of life [C2 – C4]

Then selecting systems that match the materials

being used. This study relied on Schüco products. The

first system, referred to as System A, is the Schüco

FWS 50 Si. In this system, the mullions and transoms

are made of aluminum, and the assembly type is a

stick system, where the façade is structurally selfsupported.

The profiles are highly thermally insulated

to enhance energy efficiency. System A serves as

the base design variant, as outlined in Table 2. The

next two systems are add-on constructions, where

a thermally insulated aluminum profile is added to

a steel or wood supporting structure. These are

configured as mullion-transom constructions for

multi-story façades. (“AOC,”n.d.).

Table 2. System Design

• Beyond the building life cycle [D]

• A5 and C1 are excluded from the study as they

are the installation and demolition. The scope of

this guidance is limited to embodied carbon and

therefore does not include operational carbon

modules B6 and B7. At the time of writing, it is

anticipated further guidance will support Designers

in the consideration of facades impact on the

operational carbon of the asset. The study indicator

used is the Global Warming Potential (GWP), which

quantifies the embodied carbon of the façade. GWP

measures the environmental impact of greenhouse

gas emissions over the study period. This study will

focus on evaluating the CO2-equivalents [kg CO2 eq.]

over the 60 years’ project study period. Where the

Variables and end of life assumptions are as following

where the first design Category A is calculated using

3 different materials Aluminium, Steel and Timber

where each material has 3 end of life scenarios. 27

design variant analysed.

Glass design plays a crucial role in this case study, as

the main differences lie in the glass build-up. Three

glass configurations are analyzed: two for Category

A and one for Category C2. All middle panes are float

glass, except for Option 1, which uses toughened

safety glass (TSG). To achieve the required low

U-values and g-values, coatings were applied on

the second and fifth surfaces, with a consistent

cavity thickness of 16 mm. The structural integrity

was assessed using Sommer Global, while weight

and relative U-value data were calculated with

Saint-Gobain‘s Calumen tool. In Category A, Option

1 features a floor-to-floor glazing system without a

supporting beam, requiring laminated safety glass

(LSG). Option 2 is another triple-glazing unit, where

the outer pane consists of laminated glass, and

the inner pane is toughened safety glass (TSG). For

Category C2, Option 3 is a triple-glazing unit with

TSG for both the inner and outer panes, assumed to

be used for both the upper and lower panes. While

this setup complies with regulations, laminated

glass is often preferred in practical applications for

additional safety.

Figure 6 design parameters of Materiality and

end of life scenarios.

ARTICLES


43

4. Results

Table 3. Glass Design

Followed by the end of life key assumptions in the

transportation stage (A4), aluminum and steel are

assumed to be transported from Schüco in Bielefeld

to Stuttgart, while the glass is sourced from Saint-

Gobain. An average truck trailer with a 27-ton

payload and a diesel consumption of 38 liters per

100 km is used for transportation. End-of-life (EoL)

scenarios extend the façade’s life cycle through a

modeling approach, where net credits from system

expansion are allocated in Module D. Unlike other

life cycle modules, Module D represents an abstract

accounting method for future life cycles, resulting

in negative impacts that may appear to reduce

the overall reported footprint. In this study, the

tested EoL scenarios for façades include landfilling,

recycling, and reuse. Most Environmental Product

Declarations (EPDs) for laminated and low-emissivity

glass assume a 100% landfill scenario at the EoL

stage. Wood glulam is typically incinerated as biobased

waste, often in waste-to-energy plants. The

disposal site is assumed to be 50 km away. In the

recycling scenario, the pressure plate is unscrewed to

remove the glazing, while the remaining components

are demolished. Steel and aluminum are assumed to

be fully transported to recycling facilities for closedloop

recycling. Timber frames have a higher reuse

potential, with 80% being salvageable, as they can

often be reused directly without further processing.

Aluminum reuse includes re-anodizing and recoating,

allowing it to be reused at a high percentage. Glass

reuse potential varies depending on its build-up, with

an estimated 10% going to landfill due to damage or

reduced performance. Meanwhile, gaskets, EPDM,

and insulation are landfilled as inorganic waste. After

identyfing the systems,glass options and the end

of life scenarios. The input of the case study was

calculating the weights for each façade folowed by

the evaluation of the embodided carbon (A-D) for the

glass and for the frame then combining the variants

to obtian the results.

Figure 7. Variant Combinations.

The Summary of the output done is as following.

The first Comparison illustrated the significant

role of reuse scenarios in minimizing GWP across

all profile materials. For aluminum, reuse reduces

GWP by 45% compared to demolition, while steel

demonstrates an 18% greater benefit in reuse over

recycling. Wood, consistently showing the lowest

GWP across all stages, significantly outperforms

aluminum and steel due to its inherent carbonsequestration

properties and reduced production

impacts. These findings highlight the environmental

advantages of prioritizing reuse, as it minimizes both

production and disposal emissions, delivering the

most substantial reductions in embodied carbon.

The second Comparison highlights the critical

impact of glass selection on overall GWP. Option

3 glazing, which excludes lamination, achieves

a production GWP (A1-A3) of 73 kg CO2-eq/m²,

substantially lower than Option 1‘s 118 kg CO2-eq/

m². This design change, combined with the use of

tempered safety glass, contributes to the overall

lower environmental impact in Category C2, even

when considering the higher façade weight. The

shift underscores the importance of selecting glass

designs with lower production impacts to achieve

sustainable results. Finally, the variant comparison

emphasized the compounded benefits of combining

low-impact glass options with reuse strategies for

frame materials. The reuse scenarios for Category

A and Category C2 consistently achieve lower GWP

in Module D, which demonstrates the potential

for material reuse to offset life-cycle emissions

significantly. In contrast, demolition scenarios lack

the avoided burdens, resulting in the highest GWP

impacts. The comparisons underline the necessity

of thoughtful material selection, sustainable glass

design, and effective end-of-life strategies to achieve

meaningful environmental gains in façade systems.

5. Discussion

The study‘s major findings highlight that while

wood has a lower embodied carbon footprint,

its reassembly process is more complex. An

unexpected result was that steel had fewer reuse

scenarios than aluminum, yet it performed better in

terms of environmental impact. Notably, the reuse

of both steel and wood led to negative emissions,

largely due to the selection of glass in Option 3,

which had a lower embodied carbon impact. For

the baseline scenario, the study assumed that all

end-of-life glass is recycled into aggregate. However,

alternative pathways offer a greater variety of glass

recovery options, which could influence the overall

environmental performance. Sharing insights on

different types of cullet could further enhance

understanding of glass recycling potential. One

possible optimization strategy involves using lowcarbon

glass, which is manufactured with renewable

energy and a high recycled content. Additionally,

incorporating low-carbon profile materials could

provide further benefits, offering a more sustainable

alternative to conventional systems.

44

ARTICLES


6. Conclusions

Figure 8. Discussion output.

This thesis highlights the importance of considering

end-of-life (EoL) scenarios for façades during the early

design stage. It provides a systematic methodology

to assess the materials used in façades. To achieve a

circular EoL scenario, it is necessary to use materials

with potential for circularity. Additionally, a system

with a low global warming potential (GWP) for EoL

processing is better than one with high GWP. The

results showed that wood has the lowest embodied

carbon compared to aluminium and steel, with

reusing wood producing the smallest variation in

CO2 emissions. However, challenges in disassembly

and maintenance make recycling more practical

for wood, as 80% of it is recycled to woodchips.

Aluminium’s recycling and reuse show minimal

differences due to its closed-loop recycling process.

Steel offers greater environmental benefits for reuse,

with an 18% higher benefit than recycling, as it avoids

energy-intensive processes like melting. However,

technical challenges in recovering steel without

compromising its integrity remain a challenge. The

IGU built up affect the end-of-life scenarios. As

Reusing glass panes offers significant potential to

reduce embodied carbon, with the greatest benefits

achieved by minimizing additional processing, as

demonstrated by the comparison between glass

options. All 3 glass options highlight the advantage

of reducing emissions through reuse despite

uncertainties. it was shown that transportation

emissions within Germany are minimal compared

to the production of new glass panes, encouraging

reuse considerations. For recycling, closed-loop

recycling provides substantial environmental

savings compared to open-loop processes,

especially for glass. Expanding closed-loop recycling

practices in Germany could reduce CO2 emissions

by approximately 300 kg per tonne of glass recycled

back into float glass. The practical advice to consider

Module D is to understand the material flow and

any processing work required to prepare the reused

product (Secondary Product) for reuse. For example,

re-ionizing aluminium was considered to make it

ready for reuse. Similarly, reusing glass was done

separately, depending on the glass build-up. Reusing

laminated glass is different from reusing float glass

and toughened safety glass as each one has its own

processing process for reuse. While Module D is

still in development, the concept is straightforward:

it is the difference between input and output. This

study addressed the first systematic way to consider

Module D in façades and encourages its inclusion

in the life cycle assessments of façades because it

significantly affects the decision-making process.

This study underscores the critical importance of

integrating end-of-life considerations into the early

design stages of façades to promote sustainability

and reduce environmental impacts. By emphasizing

the use of materials, designers can achieve

substantial environmental benefits. The findings

highlight the necessity of prioritizing reuse over

recycling or demolition, as demonstrated by the

significant GWP savings across different materials.

Incorporating Module D into life cycle assessments of

façades provides a systematic approach to evaluate

EoL scenarios, facilitating informed decision-making.

Ultimately, adopting circular design principles is

essential for aligning with global sustainability goals

and fostering a more sustainable built environment.

7. References

Cheong, C. Y., Brambilla, A., Gasparri, E., Kuru, A., &

Sangiorgio, A. (2024). Life cycle assessment of curtain

wall facades: A screening study on end-of-life scenarios.

Journal of Building Engineering, 84, 108600. https://doi.

org/10.1016/j.jobe.2024.108600

CWCT. (n.d.). How to calculate the embodied carbon of

facades: A methodology. Retrieved December 30, 2024,

from https://www.cwct.co.uk/pages/embodied-carbonmethodology-for-facades

Hartwell, R., Coult, G., & Overend, M. (2023). Mapping the

flat glass value-chain: A material flow analysis and energy

balance of UK production. Glass Structures & Engineering,

8(2), 167–192. https://doi.org/10.1007/s40940-022-00195-

9

Glass for Europe. (n.d.). Reuse, remanufacturing, recycling:

The case of glass for buildings. Retrieved January 9,

2025, from https://glassforeurope.com/wp-content/

uploads/2025/01/Finalpaper_Reuse_remanuf_recycling_

v2.pdf

Arup. (n.d.). Carbon footprint of façades: Significance

of glass. Retrieved December 28, 2024, from https://

www.arup.com/insights/carbon-footprint-of-facadessignificance-of-glass

Rota, A., Zaccaria, M., & Fiorito, F. (2023). Towards a quality

protocol for enabling the reuse of post-consumer flat glass.

Glass Structures & Engineering, 8(2), 235–254. https://doi.

org/10.1007/s40940-023-00233-0.

ARTICLES


45

Article

Energy Efficiency and Environmental Impact in Façade Renovation

Strategies for Modern Sacred Architecture

Summary of the Master Thesis presented for the Master of Integrated Design - Façade Design specialization

Najmeh Najafpour 1

Supervisors: Prof. Dr.-Ing. Uta Pottgiesser 1,2 , Prof. Dr.-Ing. Susanne Schwickert 1


2. Heritage & Architecture, Department of Architectural Engineering and Technology, Faculty of Architecture and the Built Environment, TU Delft, Julianalaan,

134, 2628 BL Delft, The Netherlands

Abstract

This thesis as part of the broader DFG research project, focuses on maintaining modern sacred architecture

with longitudinal hidden steel truss structures built between 1928 to 1938 in German speaking countries;

by exploring energy efficiency and environmental impact of façade renovation of such structures and how

they can be preserved and adapted for sustainable use. Using the Dreifaltigkeit Church in Herne as a case

study, the research explores adaptive reuse strategies that enhance functional and cultural relevance without

compromising historical authenticity, searching for partial adaptation rather than complete transformation. The

study evaluates thermal and energy performance, develops retrofitting strategies, and presents a structured

methodological framework that can act as guideline for similar buildings. Key findings highlight the necessity

of a holistic retrofitting approach, demonstrating that while building envelope improvements are crucial for

reducing heat loss, however upgrades to energy systems pays a crucial role as well.

Keywords: modern sacred architecture, energy-efficient retrofitting, façade renovation strategies, heritage

conservation, adaptive reuse, sustainability in architecture

1. Introduction

Façade of modern sacred architecture represents

a unique opportunity to consider both cultural

heritage and energy inefficiency issues when dealing

with renovation, making it an important subject for

research on sustainable building practices. This

thesis focuses on the façade renovation strategies

for Modern sacred buildings constructed during

the interwar period in German-speaking countries.

As part of a broader research project by DFG

(German Research Foundation) which focuses on

identifying, documenting, and maintaining modern

sacred architecture with longitudinal hidden steel

truss structures. It aligns with the third phase,

„Maintaining and Developing,“ of the DFG research

project by exploring how façade retrofitting can

enhance energy efficiency and environmental

impact of these buildings while maintaining their

architectural integrity. The research examines

energy performance challenges in such buildings,

emphasizing the need for tailored renovation

strategies that respect their historical and cultural

significance.

Despite increasing recognition of the need for

sustainable retrofitting, modern sacred architecture

remains underexplored in terms of energy-efficient

façade renovations. Existing studies on adaptive

reuse and heritage conservation often focus on

broader architectural typologies, overlooking

the unique challenges posed by churches. This

research addresses these gaps by evaluating

façade renovation strategies that improve energy

performance while ensuring compatibility with

historical preservation standards.

46

ARTICLES


2. Literature review

2.1. Modern Architecture

Modern architecture, emerging in the early 20th

centuries, was defined by its use of industrial materials,

technological innovations, and a functionalist

aesthetic. The use of reinforced concrete, glass,

and steel allowed for the construction of lighter

and taller structures (“Modern Architecture,” 2024).

The movement was driven by a desire to improve

living conditions and reshape urban environments

through efficient, standardized designs (Prudon,

2008). Modernist architects sought to move away

from ornamentation and historical styles, instead

advocating for minimalist, rational forms that aligned

with the social and technological advancements of

the time (Colquhoun, 2002).

Following the First World War, modernist architecture

gained prominence in Europe, particularly

in Germany, where it was seen as a tool for

reconstruction and modernization. The destruction

caused by the war necessitated new approaches to

rebuilding, prompting architects to adopt a pragmatic

perspective (Benevolo, 1977). This period also saw

a philosophical shift, with prioritized functionality

over aesthetics, aligning with the broader cultural

and political changes of the interwar period. As

a result, movements such as Bauhaus and Neue

Sachlichkeit (New Objectivity) emerged, emphasizing

standardization, prefabrication, and the integration

of architecture with industrial production (“Modern

Architecture,” 2024; Colquhoun, 2002).

In Germany, the interwar period was particularly

influential. The Bauhaus, epitomized this shift,

promoting a design philosophy that integrated art,

craftsmanship, and technology. By the late 1920s,

the movement had evolved into Neue Sachlichkeit,

which further emphasized functionality and realism,

rejecting the expressive tendencies of earlier

architectural styles (Gössel & Leuthäuser, 2022).

However, political changes in the 1930s disrupted

this trajectory, leading to a stagnation of architectural

innovation in Germany (Pevsner, 2008).

The adoption of modernist principles extended

to sacred architecture, where religious buildings

were aligned with contemporary materials and

construction techniques. The need for costeffective,

functional structures led to the integration

of steel trusses and concrete, allowing for expansive,

column-free interiors (Fissabre et al., 2022). This

transformation of sacred architecture reflected

broader societal shifts, where churches were

designed to be more integrated into daily life rather

than serving as monumental, isolated structures

(Nagel & Linke, 1968).

2.2. Sustainability and Preservation

With the passage of time these buildings needed to be

preserved. The preservation of modern architecture

presents distinct challenges, as they were often

constructed using experimental materials and

techniques that lack durability and energy efficiency.

Early preservation efforts focused primarily on

historical monuments, while modern architecture

was largely overlooked until organizations like

ICOMOS and DOCOMOMO began advocating for

its conservation (Macdonald et al., 2015). Over time,

sustainability has emerged as a central concern in

preservation, ensuring that conservation efforts also

align with contemporary environmental goals.

Preserving modernist structures requires balancing

cultural heritage with the need for energy

efficiency. Many buildings from this era were built

without consideration for insulation, airtightness,

or energy performance, leading to poor thermal

comfort and high energy consumption (Ayón

et. al, 2019). Modern preservation strategies

must address these shortcomings by integrating

energy-efficient materials and technologies

without compromising architectural integrity. The

Eindhoven-Seoul Statement (2012) expanded on

previous DOCOMOMO principles, advocating

for conservation approaches that incorporate

sustainability and climate resilience (Docomomo

International, n.d.). This shift acknowledges that

preserving modern architecture must also involve

upgrading its environmental performance to ensure

long-term viability.

Adaptive reuse has emerged as a critical strategy

in sustainable preservation, allowing modernist

buildings to maintain their historical significance

while meeting contemporary energy standards.

Retrofitting measures, such as improved insulation,

upgraded glazing, and energy-efficient HVAC

systems, are necessary to enhance the thermal

performance of these structures while respecting

their original design intent (Prudon, 2008).

Moreover, preservationists increasingly emphasize

rehabilitation over strict restoration, ensuring that

interventions are both reversible and compatible

with existing materials (Giebeler et al., 2012). These

adaptive approaches allow heritage buildings to

remain functional and reduce the carbon footprint

associated with demolition and new construction.

The role of international policies in shaping

sustainability practices within preservation efforts

cannot be overlooked. Frameworks such as the Madrid

Document (2011) and the Burra Charter (1979) outline

methodologies for integrating conservation with

sustainable development (ICOMOS ISC20C, 2011).

Additionally, national policies, such as Germany’s

Cultural Property Protection Act and the Federal

Building Code (BauGB), provide legal guidelines for

balancing historical preservation with environmental

upgrades (Federal Government of Germany, n.d.).

By aligning modern architecture conservation with

sustainability objectives, these regulations ensure

that energy efficiency improvements contribute

ARTICLES


47

to both heritage conservation and contemporary

climate action goals.

2.3. Energy Efficiency in Heritage

Preservation

The implementation of energy efficiency policies has

played a crucial role in shaping the preservation of

heritage buildings while addressing sustainability

concerns. Regulatory frameworks such as the

European Union’s Energy Performance of Buildings

Directive (EPBD) have established strict energy

efficiency targets, requiring member states to

improve the performance of their building stock.

This directive mandates nearly zero-energy

standards for new constructions while incentivizing

retrofits for existing buildings (Energy Performance

of Buildings Directive, n.d.). Similarly, Germany’s

Building Energy Act (GEG) integrates national energy

conservation laws to improve efficiency in both

modern and heritage structures, with exemptions

for listed buildings to balance conservation needs

(“Energieeinsparverordnung,” 2024).

At the international level, initiatives such as the Paris

Agreement (2015) and the European Green Deal

(2019) have reinforced the need to retrofit existing

buildings to meet carbon reduction targets (The

Paris Agreement | United Nations, n.d.; European

Commission, n.d.). However, implementing energy

retrofits in historic buildings presents unique

challenges, particularly in maintaining architectural

authenticity while improving thermal performance.

To address these challenges, frameworks like EN

16883 provide guidelines for integrating energy

efficiency measures while preserving historical

significance (European Standards, n.d.).

The need to retrofit modern heritage buildings

require careful adaptation of contemporary

energy efficiency measures without compromising

architectural integrity. Strategies such as passive

climate control, improved insulation, and selective

façade retrofits offer viable solutions for enhancing

thermal performance while respecting historical

structures (Troi & Bastian, 2014). However, challenges

remain in balancing regulatory requirements, costeffectiveness,

and cultural heritage considerations.

These complexities highlight the necessity of

a methodological approach that integrates

sustainability principles with the architectural

preservation of modern sacred buildings. The

following section will explore the methodological

framework adopted to address these challenges

within the context of this study.

the church‘s historical background and technical

characteristics. Finally, its location is analysed to

discuss its adaptive reuse possibilities. It is important

to note that the church is both a listed building as

well as an active place of worship, necessitating

only minimal interventions for its adaptive reuse.

As a result, the design suggestions remain limited

to respect the church’s historical and functional

significance.

Defining energy goals is the next step. These goals

are associated with the changes introduced through

retrofitting, with particular emphasis on buildingskin-related

measures. The analysis is done by

EVEBI, an energy simulation software. A detailed

assessment of the current energy performance of

the building’s façade components and proposed

retrofit measures will follow suit.

3.1. St. Dreifaltigkeit Church Overview

St. Dreifaltigkeit Church in Herne, located at

Börsinghauser Str. 60, was constructed between

1931 and 1932 by architect Karl Wibbe in response

to the rapid population growth due to coal mining

expansion in the area. The church was designed

with a steel truss structure to mitigate potential

mining-related damage, a concern raised by the

mining authorities. The interior design features a

net-like ceiling structure and a semicircular altar

area which was adorned with a mural of the Holy

Trinity by Ernst Bahn. During World War II, the

church sustained significant damage and underwent

extensive reconstruction, completed in 1946.

Further modifications included a new slate roof and

the addition of a weekday chapel in the subsequent

years. The church was officially listed as a monument

in 2009. Architecturally, it is distinguished by its

clinker brick façade, a massive west tower with

pyramid-shaped roofs, and stained-glass windows

added in the late 1960s by Nikolaus Bette.

3. Methodology

The St. Dreifaltigkeit Church in Herne, a sacred

building amongst the ones identified in the DFG

project, is the thesis sample study that will be

analyzed. The analysis begins with an overview of the

study sample, followed by a detailed examination of

Figure 1. St. Dreifaltigkeit church front view (DFG

funded project ‚525823438‘, 2024) .

48

ARTICLES


3.2. Adaptive reuse suggestions

Figure 2. Construction process of the steel

truss structure of the church (Pfarrgemeinde St.

Dreifaltigkeit HerneHolthausen, 1983, p. 35).

The church‘s surroundings provide significant

contextual insights into its adaptive reuse potential.

Positioned centrally within a neighbourhood that

accommodates families and children, with a Catholic

daycare centre to its south and an elementary

school to its north, the church is embedded in a

community-oriented environment.

Figure 4. Neighbourhood figure-ground usage plan.

Figure 3. St. Dreifaltigkeit existing plan.

The design prioritizes structural stability while

maintaining visual openness. The foundation

comprises a concrete ring with robust concrete pillars,

allowing the steel truss to be detached and realigned

if necessary. The roof features an arched steel band

structure supporting a layered construction, with

wooden shingles covering the exterior. The church

walls are composed of masonry concrete blocks

with a clinker brick exterior, a hallmark of Brick

Expressionism. This material selection enhances

durability and weather resistance while preserving

the building‘s historical character.

This spatial setting suggests an opportunity to extend

its function beyond religious services, integrating

weekday activities that align with the needs of the

locals. The neighbourhood’s mix of educational and

residential functions presents a clear framework for

the adaptive reuse function of the church as a multipurpose

space.

The adaptive reuse must balance multiple

considerations, including community needs,

architectural integrity, and religious significance.

Given the interest of church authorities in expanding

its role, proposals focus on minimal interventions

that enhance the building’s usability without

compromising its sacred character. Suggested

strategies include hosting after-school programs,

tutoring sessions, and educational workshops,

leveraging its proximity to schools. Additionally, the

church’s acoustics and open interior space make it

Figure 5. Adaptive reuse suggestion - section view.

ARTICLES


49

suitable for cultural events, such as music recitals,

art exhibitions, and community gatherings. To

achieve this, flexible interior modifications, such as

temporary partitions and adaptable furnishings, can

be introduced to create multifunctional areas while

preserving the church’s architectural authenticity.

These adaptive reuse strategies ensure that the

church remains a central spiritual hub while evolving

to meet contemporary community demands,

securing its long-term relevance.

analysed; made of concrete and plaster, exhibited

the highest thermal losses with a U-value of 3.941

W/m²K. By integrating calcium silicate and a vapour

retarder, the retrofitted version significantly lowers

this value to 0.833 W/m²K.

3.3. Thermal Performance Evaluation:

Existing and Retrofitted

The thermal performance analysis of St. Dreifaltigkeit

Church highlights the inefficiencies of the existing

building envelope in meeting the energetic needs

for modern regulations. Since the Church is a

listed building, it is exempted from complying with

Buildings Energy Act (GEG), however, implementing

such measures could set a valuable example of how

heritage buildings can achieve energy efficiency

without compromising their historical value.

The original structure exhibits high thermal losses,

particularly through the roof and windows, due

to outdated materials and insufficient insulation.

The existing U-values indicate significant heat

transfer, contributing to increased energy

demand and poor indoor thermal comfort. The

exterior walls, while somewhat more efficient, still

fall short of contemporary energy performance

standards. To enhance energy efficiency, retrofitting

measures were implemented, focusing on material

upgrades and additional insulation layers. since

detailed information about the composition of the

component was not available (during the study

process) approximation was used.

Floor

The existing floor structure consists of limestone,

mortar, cement screed, concrete, and compacted

soil, with the U-value of 1.209 W/m²K. The retrofitting

strategy introduces foam glass insulation and an

impact sound mat, significantly reducing the U-value

to 0.162 W/m²K. This enhances thermal efficiency

while ensuring structural stability and compatibility

with the original materials. Also, an overhaul of the

floor presents an opportunity to lay the pipework for

the heating system upgrades.

Roof

The roof of the whole church was analysed in two

configurations: shingle and copper covering. The

existing shingle-covered roof comprises wooden

shingles and boards, with a U-value of 1.913 W/

m²K (for the sake of simplification in the simulation

process with EVEBI). The retrofitted version

incorporates wool wood insulation and a damp

barrier, reducing the U-value to 0.129 W/m²K. as for

the copper-covered roof, only the bottom layer was

Figure 6. Roof structures map relevant to the study.

Walls

The church’s original exterior walls, constructed

from clinker bricks, cement mortar, concrete blocks,

and plaster, provided moderate insulation with a

U-value of 0.922 W/m²K. Retrofitting efforts included

the addition of calcium silicate insulation while

maintaining the original brick façade, reducing the

U-value to 0.498 W/m²K. This intervention ensures

improved thermal performance while preserving the

building’s historic character. However, the thermal

performance of the retrofitted wall can improve with

the increase in insulation depth.

Windows

The original windows, composed of single-glazed

stained glass, were the weakest thermal component,

with a U-value of 4.398 W/m²K. Retrofitting involved

adding secondary double-glazed window behind the

stained glass, significantly improving insulation and

reducing the U-value to 1.875 W/m²K. This upgrade

enhances energy efficiency while maintaining the

architectural and aesthetic integrity of the church.

These retrofitting measures collectively contribute

to reducing heat losses, improving indoor thermal

comfort, and enhancing the overall energy efficiency

of the building while preserving its historical and

cultural significance.

50

ARTICLES


Table 1. Thermal Performance Evaluation: Existing and Retrofitted

Component

Original U-value

[W/m²K]

Retrofitted U-value

[W/m²K]

Material Layers (Existing)

Material Layers (Retrofitted)

Floor 1.209 0.162 Limestone, Mortar, Cement screed,

Concrete, Compacted soil

Limestone, Mortar, Cement screed, Foam glass insulation,

Impact sound mat, Compacted soil

Roof (Shingle

Covering)

1.913 0.129 Wooden shingles, Wooden board Wooden shingles, Wooden board, Wool wood insulation,

Damp barrier, Additional wool wood insulation

Roof (Copper

Covering)

3.941 0.833 Concrete, Plaster Concrete, Calcium silicate, Damp barrier, Plaster

Exterior Wall 0.922 0.498 Clinker bricks, Cement mortar,

Concrete block, Plaster

Clinker bricks, Cement mortar, Concrete block, Calcium

silicate insulation, Plaster

Window 4.398 1.875 Single-glazed stained-glass, Wooden

frame

Double-glazed stained-glass, Reinforced wooden frame

Figure 7. Plan, elevation and section detail existing

façade.

Figure 8. Plan, elevation and section detail after

façade retrofit.

ARTICLES


51

4. Results

In this part the result of the energy retrofit will be

discussed. This is possible first through investigation

of the existing building and its current energy

consumption, and then application of the retrofitted

scenario and the subsequent changes in demand

and consumption pattern.

For ease of comprehension in the next part the

retrofitted actions are introduced as steps but by

no means do they imply the necessity of application

based on this hierarchy. On the contrary, the

recommended steps should be chosen based on

the consultation with stakeholders and experts,

immediate needs, energy regulation and financial

capacity just to name influential factors.

4.2. Energy Evaluation: Retrofitted

Step 1: Floor

The floor retrofit included insulation layers beneath

the original stone flooring, contributing to a 10.8%

reduction in primary energy demand. Heat transfer

loss improved by 12.7%, decreasing from 1.50 W/m²K

to 1.31 W/m²K. These changes enhance the thermal

efficiency of the floor, addressing one of the major

areas of heat loss.

Step 2: Roof

Roof insulation had the most significant impact,

reducing primary energy demand by 42.37% and

heat transfer loss by 56.25%, from 1.31 W/m²K to 0.68

W/m²K. This step drastically improved the building‘s

thermal envelope, as the roof was previously one of

the largest sources of heat loss.

Figure 9. Energy retrofit measure concept.

4.1. Energy Evaluation: Existing

The energy performance evaluation of the existing

church focuses on the main heated area, as it

undergoes adaptive reuse. Key metrics derived from

GEG 2024 and DIN V 18599, such as primary energy

demand (QP) and heat transfer loss (HT), serve as

benchmarks to assess efficiency. The building‘s

energy classification, based on final energy demand

(kWh/m²·a), indicates poor performance, with a

primary energy demand of 1,148.6 kWh/(m²·a)—far

exceeding benchmarks for both modernized old

buildings (301.3 kWh/(m²·a)) and new constructions.

The classification highlights the urgent need for

retrofitting measures to address excessive heat loss

and non-compliance with sustainability standards.

Additionally, energy flow analysis reveals that the

highest losses occur through the roof and walls,

followed by windows and floors.

The results underscore the necessity of enhancing

insulation, improving air sealing, and integrating

renewable energy sources to align with regulatory

requirements. The current inefficiencies not only

impact operational costs but also contribute to

high CO2 emissions, reinforcing the importance of

intervention. The next section explores potential

retrofit strategies to improve thermal performance

and energy efficiency while maintaining the

architectural integrity of the church.

Step 3: Walls

Wall insulation further enhanced efficiency, lowering

primary energy demand by 10.95% and heat transfer

loss by 14.29%, from 0.68 W/m²K to 0.52 W/m²K.

While its impact was lower than the roof, it played a

crucial role in reducing energy losses and improving

overall thermal comfort.

Step 4: Windows

The addition of secondary glazing reduced primary

energy demand by 9.08%, from 500.1 kWh/m²a

to 410.8 kWh/m²a. Heat transfer loss dropped

by 26.92%, from 0.52 W/m²K to 0.38 W/m²K. This

intervention significantly improved insulation while

preserving the church’s historical appearance.

Step 5: Heating System

A water-to-water heat pump replaced the outdated

oil heating system, reducing primary energy demand

by 48.78%. The building‘s energy efficiency class

improved significantly, decreasing from 370.8 kWh/

m²a to 116.9 kWh/m²a, marking one of the most

drastic changes in the retrofit.

Step 6: Photovoltaic Panels

The integration of photovoltaic (PV) panels further

enhanced energy efficiency, reducing primary

energy demand by 21.76%, from 210.5 kWh/m²a to

164.7 kWh/m²a. This intervention introduced on-site

renewable energy generation, decreasing reliance

on non-renewable sources.

52

ARTICLES


Table 2. Energy efficiency and primary energy demand,

Heat transfer loss and CO2 Emission reduction evaluation across the 6 steps

heating and renewable energy integration. These

results highlight the need for a holistic retrofitting

strategy that considers both passive and active

energy measures.

Figure 10. Existing (red) and retrofitted (green)

building’s energy flow.

5. Conclusions

This study explores the energy efficiency,

environmental impact, and façade renovation

strategies of modern sacred architecture, focusing

on churches with longitudinal hidden steel truss

structures. The primary objective was to assess the

thermal and energy performance of the sample case

study and propose retrofit solutions that balance

historical authenticity with sustainability. Through

the case study of the St. Dreifaltigkeit Church in

Herne, this research examines how adaptive reuse

and targeted façade interventions can extend the

functional and cultural relevance of sacred buildings

while improving their energy efficiency.

A key aspect of this study was to establish a

methodological framework for preserving and

adapting modern sacred architecture. Rather

than prescribing a universal solution, the research

comes to the conclusion that for such significant

buildings only tailored solutions could work. It

offers a structured approach that can be tailored

to individual buildings based on their architectural

and contextual conditions. The findings emphasize

that while building envelope interventions, such

as insulation and glazing upgrades, reduce heat

loss, significant improvements in energy efficiency

classification require systemic upgrades, including

By bridging the gap between heritage conservation

and energy performance optimization, this

research contributes to the broader discourse on

sustainable preservation. The study underscores

the importance of adapting sacred buildings

to contemporary energy standards without

compromising their historical significance. The

methodological approach developed here serves

as a reference point for decision-makers navigating

similar renovation challenges, ensuring that sacred

architecture remains functional, culturally relevant,

and environmentally responsible in the long term.

5.1. Limitations

This study encountered several challenges,

particularly regarding the availability and accuracy

of material data for the building components. The

lack of precise documentation for the physical

properties of materials in the St. Dreifaltigkeit

Church necessitated the use of approximations

derived from standards and literature. While these

estimates provided a reasonable basis for energy

performance simulations, they may not fully reflect

the actual thermal and structural characteristics

of the building. Additionally, material investigations

within the broader DFG project, such as 3D scanning

and sampling, were still in progress, limiting their

integration into this research. Another major

challenge arose from the church’s heritage status,

which imposed strict conservation constraints

on retrofitting measures. This restricted potential

interventions, particularly concerning façade

renovation, requiring careful alignment with

preservation regulations.

Beyond technical and regulatory constraints,

the study‘s reliance on a single case study limits

the generalizability of its conclusions. While the

developed methodology offers a structured

ARTICLES


53

framework for retrofitting modern sacred buildings,

each case demands tailored solutions based on

its unique architectural and historical context.

Time constraints also prevented the inclusion of a

comprehensive life cycle assessment (LCA), which

would have enriched the evaluation of environmental

impacts. Additionally, while EVEBI was a useful tool

for energy simulation, relying solely on one software

may have introduced biases; future research could

benefit from cross-validation with other tools.

5.2. Suggestions

To further improve the building’s energy

performance, increasing the thickness of wall

insulation in the building envelope is recommended.

A greater insulation depth would lower U-values,

reducing heat transfer and enhancing overall

thermal efficiency. However, this must be assessed

for structural feasibility and user comfort. Another

key recommendation is replacing the existing roof

composition with modern insulating materials, as the

current materials fail to meet contemporary energy

performance standards. Given the church’s heritage

status, this intervention would require approval from

conservation authorities. If a roof replacement is

undertaken, it presents an opportunity to integrate

photovoltaic (PV) panels, enabling on-site renewable

energy generation while improving energy efficiency.

Beyond direct interventions, a holistic approach

should include professional assessments for

structural stability, fire safety, and heating system

optimization. Structural engineers must evaluate

the feasibility of increasing insulation depth and

replacing the roof without compromising the

integrity of the building. Fire safety specialists

should ensure compliance with regulations,

particularly when introducing new insulation

materials. Additionally, renewable energy integration

should be optimized through detailed feasibility

studies considering shading, orientation, and

surface area. Other sustainability measures, such

as circular economy principles and embodied

carbon analysis, can further enhance the process.

Expanding renewable energy sources beyond PV

panels, including geothermal systems, could provide

additional benefits. Implementing these strategies

would enhance the building’s sustainability while

preserving its architectural and cultural significance.

6. References

Ayón, A., & Pottgiesser, U. (2019). Reglazing Modernism:

Intervention Strategies for 20th-Century Icons. Birkhäuser.

https://doi.org/10.1515/9783035619348

Colquhoun, A. (2002). Modern Architecture. OUP Oxford.

Benevolo, L. (1977). History of Modern Architecture. MIT

Press.

Deutsche Forschungsgemeinschaft (DFG). (2024). Project

525823438. Retrieved from https://gepris.dfg.de/gepris/

projekt/525823438

Docomomo International. (n.d.). Retrieved January 24,

2025, from https://docomomo.com/organization/

Energieeinsparverordnung. (2024). In

Wikipedia.

https://en.wikipedia.org/w/index.

title=Energieeinsparverordnung&oldid=1241390077

Energy Performance of Buildings Directive. (n.d.). Retrieved

January 4, 2025, from https://energy.ec.europa.eu/topics/

energy-efficiency/energy-efficient-buildings/energyperformance-buildings-directive_en

European Commission. (n.d.). Renovation wave. Retrieved

January 2, 2025, from https://energy.ec.europa.eu/topics/

energy-efficiency/energy-efficient-buildings/renovationwave_en

European Standards. (n.d.). CSN EN 16883—Conservation

of cultural heritage—Guidelines for improving the energy

performance of historic buildings. Https://Www.En-

Standard.Eu. Retrieved January 4, 2025, from https://

www.en-standard.eu/csn-en-16883-conservation-ofcultural-heritage-guidelines-for-improving-the-energyperformance-of-historic-buildings/

Federal Government of Germany. (n.d.).

Kulturgutschutzgesetz – Gesetz zum Schutz von Kulturgut.

Kulturgutschutz Deutschland. Retrieved December 28,

2024, from https://www.kulturgutschutz-deutschland.de/

Fissabre, A., Rottke, E., Pottgiesser, U., & Thiele, K. (2022).

Längsbinderkirchen und versteckte Stahlkonstruktionen

im Sakralbau der Hochmoderne. [Unpublished project

report]. FH Aachen, TH OWL, TU Braunschweig.

Giebeler, G., Krause, H., Fisch, R., Musso, F., Lenz, B., &

Rudolphi, A. (2012). Refurbishment Manual: Maintenance,

Conversions, Extensions. Birkhäuser. https://doi.

org/10.11129/detail.9783034614337

Gössel, P., & Leuthäuser, G. (2022). Architektur des 20.

Jahrhunderts. TASCHEN.

ICOMOS ISC20C. (2011). Approaches for the Conservation

of Twentieth-Century Architectural Heritage (Madrid

Document 2011).

Macdonald, S., Normandin, K. C., & Kindred, B. (2015).

Conservation of Modern Architecture. Routledge.

Modern architecture. (2024). In Wikipedia. https://

en.wikipedia.org/w/index.php?title=Modern_

architecture&oldid=1260115736

Nagel, S., & Linke, S. (Eds.). (1968). Kirchliches Bauen.

Pevsner, N. (2008). Europäische Architektur: Von den

Anfängen bis zur Gegenwart (9. Complete Overcoloured.

edition). Prestel Verlag.

Pfarrgemeinde St. Dreifaltigkeit Herne-Holthausen. (1983).

Festschrift der Pfarrgemeinde St. Dreifaltigkeit Herne-

Holthausen anlässlich des 75-jährigen Bestehens der

Pfarrgemeinde. Pfarrgemeinde St. Dreifaltigkeit.

Prudon, T. H. M. (2008). Preservation of Modern

Architecture (1st edition). Wiley.

The Paris Agreement | United Nations. (n.d.). United

Nations Climate Change. Retrieved January 4, 2025,

from https://www.un.org/en/climatechange/parisagreement?utm_medium=website&utm

Troi, A., & Bastian, Z. (Eds.). (2014). Energy Efficiency

Solutions for Historic Buildings: A Handbook. Birkhäuser.

https://doi.org/10.1515/9783038216

54

ARTICLES


Integrating Machine Learning with Circular Economy

Article

Bahareh Hemmatikhanshir 1


Abstract

The growing challenges of environmental degradation and resource scarcity have highlighted the urgent

need for a shift from traditional linear economic models to circular economy (CE). The concept of circularity

economy aims to minimize waste and optimize resource use by promoting practices like product reuse, repair,

and recycling. However, the practical implementation of CE faces significant barriers, including complexities

in reverse logistics, product lifecycle prediction, and recycling processes. Machine learning (ML) has emerged

as a powerful tool to overcome some of these obstacles, offering solutions such as predictive maintenance,

intelligent sorting, and optimized resource management. This paper explores the integration of ML into circular

economy practices, particularly in the context of the architecture, engineering, and construction (AEC) industry.

By reviewing recent literature, we examine how ML can support circular economy principles, identify the current

applications and effectiveness of ML in promoting CE, and explore the potential for scaling and optimizing MLbased

solutions. Furthermore, we discuss the technical and organizational barriers to implementing ML in CE,

aiming to bridge the gap between technological advancements and practical adoption. This research provides

insights into the future potential of ML to accelerate the transition toward a sustainable circular economy.

Keywords: machine learning, circular economy, artificial intelligence, sustainability, AEC industry

1. Introduction

Environmental degradation, resource scarcity, and

technological advancement have caused a paradigm

shift from traditional linear economic models toward

circular economy (CE) frameworks. As global waste

generation is projected to reach 3.4 billion tones

by 2050, the imperative to transition from a ‚takemake-waste‘

model to a regenerative system has

never been more urgent. This disruptive production

approach has raised serious concerns regarding

health, biodiversity, climate, and our overall

atmosphere (Kaza et al., 2018).

A promising solution to these issues, is known as

circularity which is the idea of diminishing waste

production by designing products that can be

reused, repaired, refurbished, upgraded and

disassembled; hence, extending a product‘s life

cycle to its maximum. The circular economy concept,

which aims to separate economic growth from

resource consumption through closed-loop systems,

faces significant operational challenges in its

practical implementation. These challenges include

the complexity of reverse logistics, the difficulty in

predicting product lifecycles, and the inefficiencies

in waste sorting and recycling processes.

Recent technological advancements in artificial

intelligence (AI) and machine learning (ML) have

created unprecedented opportunities to enhance

the effectiveness of circular economy initiatives (All

Noman et al., 2022). Within this context, machine

learning (ML) emerges as a transformative tool that

can accelerate the implementation and optimization

of circular economy principles across architecture,

engineering, and construction (AEC) industry.

ARTICLES


55

From predictive maintenance that extends product

lifespans to intelligent sorting systems that improve

recycling efficiency, ML algorithms are increasingly

being utilized to support circular business models.

However, despite these developments, there

remains a significant gap in our understanding of

how ML applications can be systematically integrated

into circular economy frameworks to maximize their

impact. This research paper aims to address this

knowledge gap by providing an analysis of current

machine learning applications in circular economy

context, and identifying potential areas for future

development. Through a review of existing literature

and studies, ML was examined how it can serve as

a catalyst for circular economy adoption across AEC

industry and scales of operation.

The volume and area of research related to the

circular economy using machine learning approaches

have significantly increased, creating a vast amount

of bibliometric information (All Noman et al., 2022).

In this research, we presented a study of literature

concerning the adoption of machine learning in the

circular economy.

This article focuses on three primary research

questions:

1. What are the current applications and effectiveness

of ML in supporting circular economy principles?

2. How can ML applications be scaled and optimized

to accelerate the transition toward a circular

economy?

The selected literature was then categorized into

thematic groups: ML for waste reduction, product

lifecycle optimization, supply chain and resource

efficiency, and energy savings. This categorization

facilitated a focused analysis of how ML contributes

to various aspects of the circular economy. For each

study, details were extracted on their objectives,

methodology, and outcomes, emphasizing their

contributions to circular economy goals such as

reduced waste, cost savings, and material recovery

rates.

2.1. Understanding Circular Economy

The circular economy represents a paradigm shift

from the traditional linear economic model of „takemake-dispose“

to a regenerative approach that

emphasizes the „reduce, reuse, recycle“ principle

(Ellen MacArthur Foundation, 2019). Any system

based on continual extraction and consumption

will eventually experience limits to growth. Today’s

economy is hugely wasteful, which results in large

losses of value (Vogiantzi et al., 2023) For example,

in 2016 the world produced 45 million tonnes of

electronic waste (e-waste), with an estimated value of

EUR 55 billion in raw materials. A hefty portion of this

value is never recovered, as only 20% of this waste

is collected and recycled appropriately. Similarly,

the global food system currently grows more than

enough food to feed the world’s population, but

roughly a third is lost or wasted throughout the

supply chain and during consumption (United

Nations, 2011).

3. What technical and organizational barriers exist

in implementing ML solutions for circular economy?

2. Methodology

This literature review aims to explore the intersection

of machine learning (ML) and circular economy (CE)

by identifying key themes, recent advancements, and

research gaps in the application of ML for circular

practices. The scope of this narrative review is

limited to peer-reviewed journal articles, conference

proceedings, and reports from the past 20 years,

ensuring that the analysis reflects developments and

state-of-the-art applications. The primary keywords

included „machine learning,“ „circular economy,“

„product lifecycle,“ along with secondary terms like

„predictive modelling“ and optimization“.

To identify relevant literature, databases such as

IEEE Xplore, Scopus, Web of Science, and Google

Scholar were used. Inclusion criteria required that

selected studies focus on ML applications that

directly address circular economy principles, such

as waste reduction, recycling, lifecycle optimization,

and supply chain efficiency. articles that focused on

environmental studies or recycling practices without

the integration of ML or CE objectives were excluded.

Figure 1: Linear, Recycling and Circular Economies.

This transformation is driven by increasing

environmental concerns, resource scarcity, and the

need for sustainable business practices. The concept

extends beyond mere recycling to encompass the

entire product lifecycle, from design and production

to consumption and recovery. The fundamental

difference between circularity in consumer goods and

the built environment lies in their scale, complexity,

and lifespan characteristics. While consumer goods

are typically designed for easy disassembly and

recycling (like cars with 95% recyclability), buildings

present unique challenges due to their massive

scale, 30-50 years lifespan, and complex layered

construction methods. (Voulvoulis, 2022). Buildings

56

ARTICLES


often require heavy machinery for demolition and

face challenges with material separation due to

common practices like wet construction methods,

hidden installations, and extensive use of adhesives

and sealants. To address these challenges, the future

of circular building design must focus on Design

for Disassembly principles, modular construction

systems, exposed systems for easy maintenance,

and dry construction methods prioritization. This

shift requires not only technical innovations but

also systemic changes, including standardization

of building components, development of reversible

connection systems, and integration of circularity

principles in building codes. Unlike consumer

goods where repair, reuse, and recycling pathways

are well-established, the built environment needs

specific solutions that account for its unique

characteristics while still achieving circular economy

goals of waste reduction and resource efficiency.

Another example from the AEC industry would be

“Villa Welpeloo house and art studio” designed and

constructed by Superuse Studios in 2005. Whilst the

house is certainly architecturally striking, there are

two features of its creation that make it especially

noteworthy. Firstly, 60% of the house is made up

of materials salvaged from the local area, Steel was

also sourced from machinery previously used in

textile production, a once-prominent industry in

the Enschede region of the Netherlands, where the

house is located. The wood used in the facade was

taken from 200 damaged cable reels, which gave

pieces of uniform size and shape. This wood would

traditionally be turned into particleboard (or worse,

end up incinerated) effectively shortcutting the

usefulness of the material. The desire to salvage also

led to the design process being conducted in parallel

with the materialization process. The „Superuse“

strategy of changing a material’s performance has

not only been adopted as the name of the firm itself

but has also been researched and used on around

90% of its 180 projects (Bartolini, 2021). In a circular

economy, creating value is increasingly decoupled

from consuming finite resources. It presents

organisations small and large, local and global,

private and public, with the potential to create an

economy that is distributed, diverse, and inclusive.

Related to the role of the architectural designer,

Galle et al. (2015) discussed the need to change from

the short-term involvements of the designer to longterm

engagements to encourage lifecycle thinking

and the well-considered management of buildings.

Kozminska (2019) argued that the circular design

process differs substantially from the standard

design approach based upon the investigation of a set

of architectural case studies. Accordingly, the design

process requires interdisciplinary collaboration

and should encompass the lifecycle of materials to

define future methods of maintenance, disassembly

and the reuse of materials. Finally, Kanters (2020)

discussed how architects can play a pivotal role in

the transition to a CE by linking different actors (e.g.,

client, contractor, other consultants, engineers) but

will need to develop leadership skills to fulfil this role.

In addition, they will need to develop the ability to

work with flexibility in the design process and acquire

deeper material and construction knowledge.

2.2. Understanding Machine Learning

Machine learning is a branch of Artificial Intelligence

that benefits from computer algorithms that learn

from data, analyse and draw inferences from

complex data patterns, and make predictions with

minimal human intervention. (Zhou, 2021). ML

algorithms have been developed throughout the past

decades, based on statistical methods, automated

and optimized to provide predictions. This training

process can be repeated and configured to improve

the quality of derived results. ML algorithms can

detect significant dependencies between the

data features of real-time datasets and this ability

can identify opportunities for circular solutions.

(Prioux et al., 2023). An intelligent economic system

continuously demands innovative solutions to boost

the quality and sustainability of actions relate to

the whole system while diminishing costs. In this

circumstance, technologies driven by artificial

intelligence are ready to render in the new industrial

paradigms (Gupta, 2018). Artificial intelligence is

organized into various subsets like data mining,

machine learning and deep learning. Artificial

intelligence is a combination of mathematical

reasoning and error reducing functionalities (Awan

et al., 2021). ML, as part of the emergent „Fourth

Industrial Revolution”, can support and accelerate

the pace of human innovation to design products,

bring together aspects of successful circular business

models, and optimise the infrastructure needed to

loop products and materials back into the economy.

Utilising ML capabilities could create a step change

which goes beyond realising incremental efficiency

gains to help design an effective economic system

that is regenerative by design (Ellen MacArthur

Foundation, 2010). The contribution of AI has been

proven significant towards making the ground to

achieve global sustainable development (Oke, 2004).

Therefore, artificial intelligence can be a great aid in

solving vital issues related to an intelligent circular

economic system (e.g., sustainable manufacturing

system, waste management, reverse logistics,

optimization of energy sources, supply chain

management).

Creating and implementing AI-based applications

requires a set of basic elements to be in place.

Experts are needed for algorithm optimization and

development, preparation of training data and the

translation of the algorithm output into results that

make sense for human needs. Another requirement

is the availability of sufficient high-quality data to

train the algorithm. „Rubbish in, rubbish out“ means

that badly engineered data leads to poor quality

outputs. According to Haefner et al. (2023), despite

creating 2.5 quintillion bytes of data daily (as a

comparison, this number is equivalent to a quarter

of all living insects at any moment), most of this data

is not usable for AI due to insufficient data labelling.

ARTICLES


57

Also, data privacy and security can limit usage and

access. This points to another basic element: AI

infrastructure. For example, to capture value from

AI, organisations need to establish digital processes,

an open culture around AI, and on a technical level,

appropriate processing power to handle all data

inputs (Ellen MacArthur Foundation, 2019).

In summary, the need for ML stems from the

inherent challenges posed by the abundance of

data and the complexity of modern problems. By

harnessing the power of machine learning, we can

identify hidden insights, make accurate predictions,

and revolutionize industries, ultimately shaping a

future that profits from intelligent automation and

data-driven decision-making.

3.Result

3.1. Current effectiveness of ML in

supporting CE

According to recent research, digital technologies

have an urgent role and increasing involvement

to enhance CE solutions to overcome current

challenges (Bressanelli et al., 2018; Kortelainen et

al., 2019). Digital technologies contribute to product

visibility through intelligent sensors and provide

information on assets, location, condition and

availability (Antikainen et al., 2018). Currently, one

of the most important roles of circular business

models is to share and lease the products instead of

selling (Bocken et al., 2016; D. Waughray et al., 2018)

mention that digitalization is one of the key solutions

in accelerating the move towards circularity.

Moreover, utilizing digital technologies such as AI,

IoT or Blockchain enhances the ways in developing

and improving transparency and traceability

throughout product lifetime (Stankovic, 2017). In

a digital world, producers have the opportunity to

monitor, control, analyze and optimize products’

performance through smart, connected products

and to collect valuable data of the usage of materials,

components and goods (Porter et al. 2014). ML

has emerged as a powerful tool in supporting CE

principles, with current applications demonstrating

its capacity to improve resource efficiency, extend

product lifecycles, and enhance waste management

processes. From an architectural perspective, ML can

play a transformative role in advancing CE principles

through smarter, more sustainable building design,

material selection, and lifecycle management. ML

techniques are actively used across various CE

practices:

3.1.1. Material Selection and Optimization for

Longevity:

ML models can analyse historical data on building

materials, evaluating durability, environmental

impact, and maintenance needs over time.

This enables architects and engineers to select

materials with lower carbon footprints and

longer lifespans, aligning with circular economy

principles. For instance, ML algorithms can assess

the environmental impact of different materials by

analysing embodied carbon data and predicting their

performance under specific climate conditions. By

selecting sustainable materials that require minimal

replacement or maintenance, architects can design

buildings that are inherently circular, contributing to

resource conservation over the structure’s lifecycle.

Recent studies from the Building Research

Establishment (BRE) demonstrate compelling

evidence for ML‘s effectiveness in sustainable

building material selection. Analysis of 50,000

material samples across 25 years of historical data

shows that ML models achieve 88-94% accuracy in

predicting material performance. When examining

specific materials, ML-enhanced assessment has

extended predicted lifespans significantly: concrete

durability estimates improved from 50-60 years to

65-75 years (92% accuracy), while steel projections

increased from 40-50 years to 45-55 years (89%

accuracy) (BRE, 2023).

Table 1: Material lifespan analysis (source: BRE,2023)

“According to International Journal of Sustainable

Construction, 2023. Optimizing Materials for

Sustainability: Machine Learning Applications

in Concrete Mixtures. International Journal of

Sustainable Construction, 12(4), pp. 134-145”. the

environmental impact is particularly noteworthy,

with ML-optimized concrete mixtures reducing

embodied carbon from 333 kg CO2e to 278 kg COe

per cubic meter, representing a 16.5% reduction.

Performance under varying climate conditions

has also improved, with ML predicting material

degradation at 8-10% per decade compared to

traditional assessments of 12-15%, marking a 35%

improvement in prediction accuracy. Cost-benefit

analysis over a 50-year lifecycle reveals that while

ML-optimized solutions have higher initial costs

($98/m² versus $85/m² for traditional materials),

they result in lower maintenance costs ($2.8/m²/

year compared to $4.2/m²/year), leading to total

lifecycle savings of $57/m². Implementation results

from 15 commercial buildings using ML-optimized

materials show remarkable improvements: 24.5%

better energy efficiency, 32.7% reduction in

maintenance costs, 15.3% increase in material

longevity, and a 27.8% decrease in carbon footprint.

The ML models, utilizing both Random Forest (91%

accuracy) and Neural Network (89% accuracy)

approaches, consider multiple variables including

weather resistance (35% importance), material

composition (28%), installation methods (22%), and

environmental factors (15%). These improvements

translate to substantial environmental benefits per

building, including annual reductions of 23.5 metric

58

ARTICLES


tons in CO2 emissions, 18.7% in water usage, 21.3%

in energy consumption, and 15.9% in waste material

(Adel, 2023).

3.1.2. Predictive Maintenance and Lifecycle

Extension of Building Components

ML-based predictive maintenance systems can help

monitor the condition of a building‘s façade, HVAC

systems, and structural elements in real-time. By

using sensor data to forecast when components

may need repair or replacement, architects and

facility managers can take preventative actions,

extending the life of building components and

reducing waste (Hennik Group, 2020). For example,

a machine learning system might detect early signs

of façade degradation due to exposure to salty

winds in coastal areas or fluctuating temperatures.

With timely interventions, the building’s façade

can be preserved for longer, reducing the need for

frequent replacements and minimizing material

waste—a key circular economy goal. ML will expand

our capability to retain, analyse, make predictions,

and make informed decisions from collected data.

Not only helping operators to make decisions, but

ML is currently performing cognitive functions

traditionally reserved for humans. In the facility

management profession, operationalized ML can

provide unbiased repair responses and investment

decisions. Full operational capability will be achieved

when AI is monitoring the operational characteristics

of the facility systems, records the data, analyses

the data, develops recommendations based on the

data, and presents the recommendations to facility

management professionals to make decisions (Feng,

C. et al, 2020).

3.1.3. Design for Deconstruction and Adaptive

Reuse:

ML can significantly enhance design strategies that

support circular economy principles by optimizing

the reuse and recycling potential of building

components. By analyzing historical data from past

construction projects, ML algorithms can identify

which structural systems, connection methods,

and material choices are most conducive to easy

disassembly. For instance, models can examine the

performance and flexibility of various connection

types, guiding architects towards selecting

components that are more easily detached and

reused, thereby extending the lifecycle of materials

(Bianchine et al., 2019). Additionally, ML can optimize

modular construction approaches by studying

deconstruction patterns to recommend the use of

prefabricated components. This not only accelerates

construction and assembly but also simplifies future

disassembly, allowing entire sections of buildings

to be reconfigured or relocated with minimal waste

(Scipioni et al., 2021). Furthermore, predictive analysis

capabilities of ML systems can assess the condition

and reuse potential of materials, such as steel

beams, wood panels, or facade elements, before

demolition begins. This enables construction firms

to recover high-value materials efficiently, optimizing

resource flows and reducing the environmental

impact associated with conventional demolition

(Bianchini et al., 2019). By focusing on adaptive reuse,

these technologies contribute to a more sustainable

and circular approach in the construction industry.

3.1.4. Optimizing Energy Efficiency and

Operational Sustainability:

ML significantly contributes to optimizing energy

efficiency and sustainability in building operations. By

integrating ML algorithms into energy management

systems, it becomes possible to dynamically adjust

heating, ventilation, air conditioning (HVAC), and

lighting based on real-time data, such as occupancy

levels, weather conditions, and sensor feedback.

These systems help reduce unnecessary energy

consumption by responding to actual building usage,

thereby aligning with circular economy principles that

emphasize minimizing resource waste throughout a

building’s operational life. For instance, by analyzing

patterns in occupancy and environmental data, ML

models can predict peak usage times and adjust

energy settings to ensure that systems are only

active when needed, which not only conserves

energy but also lowers the building‘s overall

carbon footprint (Cambridge University Press and

Assessment, 2024). This predictive approach allows

for smarter energy consumption, reducing both

costs and environmental impacts over time, which

is vital for achieving sustainable building practices

(Challa et all., 2024). Integrating such intelligent

systems into architectural design can ensure that

buildings are more energy-efficient from the start,

supporting long-term sustainability goals.

3.2. Integration of ML and CE

The integration of machine learning (ML) into the

circular economy has the potential to revolutionize

sustainable practices across industries by maximizing

resource efficiency, minimizing waste, and enhancing

product longevity. According to a study by the Ellen

MacArthur Foundation (2019), digital technologies

like ML are essential for transitioning to a circular

economy, providing data-driven insights that help

designers select materials with lower carbon

footprints and optimize products for recyclability

from the outset. Predictive maintenance algorithms,

for example, enable manufacturers to anticipate

equipment failure, which can reduce waste and

extend product lifespan—a vital approach to

preserving resources in a circular framework (Park

et al., 2021). Additionally, ML improves sorting and

recycling efficiency by using computer vision to

identify and categorize waste materials, a method

shown to increase recycling rates and resource

recovery, as demonstrated by research from the

World Economic Forum 2020. In supply chain

management, ML’s predictive capabilities offer

ARTICLES


59

actionable insights to streamline processes, reduce

emissions, and promote sustainable decisionmaking.

Together, machine learning and the circular

economy foster a resilient, closed-loop system that

aligns environmental responsibility with economic

efficiency, paving the way for a more sustainable

future.

Taking design as an example, ML could be used to

improve and speed up the design and material

selection process to improve the circularity of nearly

all materials and products. ML could help material

scientists and designers develop solutions for the

30% of plastic packaging that requires fundamental

redesign and innovation, (McKinsey & Company,

Artificial Intelligence: Construction technology’s

next frontier, 2018) or engineers and architects to

optimise building design features based on circular

design principles, such as the type of connections

or architectural finishes (Ellen MacArthur 2019). In

CE, ML can also enable autonomous and remote

monitoring of manufacturing efficiency and product

end-of-life cycles (Ghoreishi and Happonen, 2020).

According to Ramadoss et al. (2018), a substantial

amount of data originates during the manufacturing,

during usage, and during disposal process of a

product, component, or material. AI can be utilized to

effectively analyze this data for further development

of these processes. Ghoreishi et al. (2020) found

that circular design tools and methods can help

businesses improve product circularity according

to artificial intelligence. Supply chains, logistics, and

asset management technologies have also seen

major changes with the increasing use of AI, IoT

concepts, 3D printing, Advanced Robotics, wearable

devices, and Augmented Reality (AR). In recent years,

there has also been an ongoing trend to combine

artificial intelligence with all aspects of CE.

3.2.1. Data-Driven Optimization with ML

A key advantage of ML in the CE space is its ability

to process vast amounts of data from various

sources, such as IoT devices, smart sensors, and

supply chain management systems (Prida, 2021). By

integrating data from different stages of the product

lifecycle, ML algorithms can accurately forecast

material flows, identify recycling opportunities,

and enhance resource recovery processes. For

example, cloud-based platforms like Microsoft

Azure and Google Vertex AI offer scalable solutions

that allow industries to deploy ML models across

global operations, thus optimizing material reuse

and minimizing waste (Pathan et al., 2023). These

platforms facilitate automated feature engineering

and model deployment, enabling companies to

streamline their sustainability efforts through datadriven

insights.

3.2.2. Real-Time Decision-Making Using Edge

Computing

In addition to cloud-based solutions, the use of

edge computing is becoming essential for real-time

optimization in circular economy applications. Edge

computing is a distributed computing paradigm that

brings computation and data storage closer to the

location where it is needed, rather than relying solely

on centralized cloud data centers. This proximity to

the „edge“ of the network reduces latency, enhances

speed, and improves the overall performance of

applications, especially those requiring real-time

data processing (Grace A. Lewis, 2019). By processing

data locally on devices, ML models can make

instant decisions in contexts such as automated

waste sorting or smart building management

systems (Pathan et al., 2023). This reduces latency

and improves the efficiency of systems that

require immediate feedback, such as identifying

contaminants in recycling streams or adjusting

adaptive facades in response to environmental

changes. The ability to react quickly to data inputs

supports the CE‘s objective of reducing waste and

optimizing resource efficiency.

Correct use of technology can boost efficient reverse

logistics & materials and goods considerations that

then gain second life and also it accelerates the

CE concept worldwide with the suitable recycling

process, which uses limited resources (Benton

et al., 2020). But for efficient reverse logistics,

talented and knowledgeable logistics operators will

be needed. Operators who know how to position

themselves correctly between manufacturers and

subcontractors (E. Salmela et al, 2009). A combination

of digitalization driven technologies and novel

business models innovation may provide significant

new opportunities towards more sustainability for

industries in terms of value creation, value capturing

and CE (R. J. Lanzafame, 2015). For example, by

using digital design processes to build one of the

configurable products, in a sustainable manner.

(Sitra, 2018) mentions that manufacturing industries

can gain tangible benefits by a digital reinvention of

the industry to move towards Circularity. However,

some technologies are known to be prone to risks

that must be considered and balanced with possible

higher rewards and benefits these technologies

offer compared to more traditional options. As an

example, one way of doing this is to do feasibility

analysis for the new technology (Happonen et al.,

2015) and compare it directly against know and well

matured traditional (golden standard) solutions.

3.2.3. Intelligent manufacturing

AI provides features such as reasoning, acting and

learning in an industrial manufacturing system

and therefore is capable to play a key role in future

manufacturing systems development efforts. With

the use of ML technology as a complement of human’s

skill which deals more effectively with complexity,

human involvement in IMS is minimized (R. Y. Zhong,

2017). According to Li (2017), the application of ML

in the product lifecycle mainly consists of “intelligent

cloud product design technology, intelligent cloud

innovation design technology, intelligent cloud

60

ARTICLES


Figure 2. AI development and the future state of AI techniques (World Economic Forum and A.T.Kearney, 2017).

production equipment technology, intelligent cloud

operation and management technology, intelligent

cloud simulation and experiment technology, and

intelligent cloud service guarantee technology”.

AI can utilize production optimization in

manufacturing companies. For example, machine

learning techniques can be employed to be used

in identification tasks, where the system needs to

do root cause related identifying tasks for ranking

purposes to be able to define probable root causes

of production challenges (Seebo, 2019).

3.3. Challenges

Implementing ML in support of the CE involves

tackling various technical and organizational barriers.

These challenges stem from issues related to data

management, infrastructure, skills, and company

culture, as well as regulatory hurdles.

3.3.1. Technical Challenges

Data Fragmentation and Quality Issues

High-quality data is critical for ML algorithms to

deliver accurate predictions and optimizations.

However, data relevant to CE—such as material

flows, recycling rates, and lifecycle assessments—is

often fragmented across different stakeholders and

lacks standardization (All Noman et al., 2022). For

instance, companies may collect data in silos, using

different formats and inconsistent metrics, making

it difficult to consolidate and analyse effectively

(Pathan, 2023). Additionally, much of the data on

material use and waste management is not digitized

or properly structured, limiting the capability of ML

models to process it efficiently.

Scalability of ML Models

Circular economy applications often require

sophisticated models capable of handling large

volumes of data to optimize processes like waste

sorting, resource recovery, and supply chain logistics

(pathan, 2023). However, scaling these ML models

to different industries with varying levels of digital

maturity can be challenging. For example, deploying

models for predictive maintenance in manufacturing

or optimizing the recyclability of materials

involves significant computational resources and

infrastructure investments (All Noman, 2022). The

complexity increases when real-time processing

is needed, such as in smart waste management

systems, where delays in data processing can reduce

efficiency. However, implementing AI is not easy

and requires experts for algorithm development,

preparation of training data as well as translating

the algorithm output into the meaningful results

for humans (Ellen MacArthur Foundation, 2019), to

train the algorithm, the availability of sufficient highquality

data is required. Poor quality outputs result

from badly engineered data, in other words, rubbish

in, rubbish out.

3.3.2. Policy Barriers

In addition to technical and organizational barriers,

policy barriers also significantly hinder the

ARTICLES


61

implementation of ML solutions for the CE. These

barriers often arise from misaligned regulations, lack

of incentives, and the absence of a supportive legal

framework.

Implementing ML solutions in the CE faces significant

policy barriers that hinder widespread adoption.

One major challenge is the lack of standardized

regulations across regions, leading to fragmented

policies and unclear legal definitions for key

terms like „waste“ and „secondary raw materials“

(Geissdoerfer et al., 2020). Additionally, insufficient

incentives for data sharing, coupled with stringent

data privacy laws such as GDPR, limit the availability

of lifecycle data necessary for ML applications

(Bakker et al., 2021). Governments often prioritize

traditional waste management over innovative, MLdriven

circular solutions, and limited funding for

research and development further slows innovation

(Kirchherr et al., 2018). Extended Producer

Responsibility (EPR) policies also present obstacles,

as they lack mechanisms to encourage the use of

ML for optimizing resource recovery and recycling

while imposing complex compliance requirements

on companies (Benton & Hazell, 2020). Furthermore,

international trade barriers restrict the flow of

recycled materials, reducing the effectiveness of ML

solutions designed for global supply chains (Bocken

et al., 2020). These policy gaps and regulatory

inconsistencies pose significant challenges to the

integration of ML technologies in circular economy

initiatives.

4. Discussion

Trends and advancements in ML applications for

circular economy were identified. This review also

highlights key research gaps, such as limited largescale

implementation studies and challenges with

data accessibility. Lastly, implications for future

research and policy are discussed, underscoring

the potential for ML to transform circular economy

practices and recommending areas for further

exploration, such as the integration of ML with IoT

and blockchain technologies.

AI can help unlock circular economy opportunities

by improving design, operating business models,

and optimising infrastructure. Machine learning (ML)

can play a transformative role in product design by

enabling predictive modeling and generative design

techniques, which optimize materials, durability, and

recyclability from the outset. For instance, neural

networks can be used to simulate product lifecycles

and predict the environmental impact of various

design choices, facilitating the development of

products that are easier to reuse, repair, or recycle.

Reinforcement learning algorithms can optimize

circular business models, such as product-as-aservice

(PaaS) or reverse logistics, by continuously

learning and adjusting strategies to maximize

resource efficiency and minimize waste (Kalmykova

et al., 2018).

Despite these advancements, significant research

gaps remain. One notable gap is the limited number

of large-scale, real-world implementation studies

that evaluate the effectiveness of ML solutions in

diverse circular economy contexts. These studies

are critical for understanding the scalability

and generalizability of ML technologies across

industries, such as construction, electronics, and

textiles (Murray et al., 2017). Data accessibility and

interoperability continue to be a major challenge, as

circular economy systems require data from multiple

stakeholders, often stored in disparate formats

and systems (Geissdoerfer et al., 2020). Addressing

these challenges will require the development

of standardized data-sharing frameworks and

collaborative platforms that incentivize transparency

and data exchange among supply chain actors.

Future research should focus on the integration of

ML with emerging technologies like the Internet of

Things (IoT) and blockchain. IoT devices can provide

real-time data on resource usage, product conditions,

and waste generation, which ML algorithms can

analyze to optimize circular processes in real-time.

Blockchain technology can enhance data integrity

and traceability, making it easier to track products

and materials throughout their lifecycle and ensure

compliance with circular economy principles (Benton

& Hazell, 2020). Additionally, policymakers must play

a proactive role by creating regulatory frameworks

that support innovation, encourage data sharing,

and promote the adoption of AI-driven circular

economy solutions. By addressing these technical,

organizational, and policy barriers, ML has the

potential to significantly enhance the efficiency,

scalability, and impact of circular economy practices,

driving a transition toward more sustainable and

resilient economic systems.

5. References

All Noman et al., Annals of Emerging Technologies in

Computing (AETiC) Vol. 6, No. 2, 2022. Review Article:

Machine Learning and Artificial Intelligence in Circular

Economy: A Bibliometric Analysis and Systematic Literature

Review.

Ayoola Oke, Sunday. „A Literature Review on Artificial

Intelligence.“ International Journal of Information and

Management Sciences, Vol. 19, No. 4, pp. 535-570, 2004.

Bakker, C. A., et al. (2021). Circular Economy Policies and

Data Sharing. Journal of Industrial Ecology.

Benton, D., & Hazell, J. (2020). Building a Circular Economy:

Barriers and Policy Solutions. Ellen MacArthur Foundation.

Bocken, N. M. P., et al. (2020). Barriers to Implementing

Circular Economy in Supply Chains: An International

Perspective. Journal of Cleaner Production, 248, 119238.

Building Research Establishment (BRE) Database, 2023.

Ellen MacArthur Foundation (2017). New Plastics Economy:

Catalysing Action.

Ellen MacArthur Foundation (2019). Cities and Circular

62

ARTICLES


Economy for Food.

Ellen MacArthur Foundation. Artificial Intelligence and the

Circular Economy.

Ellen MacArthur Foundation. Towards a Circular Economy:

Business Rationale for an Accelerated Transition. Greener

Management International, 20 (2015).

Ellen MacArthur Foundation; Drawing from Braungart &

McDonough, Cradle to Cradle (C2C).

Environmental Building Science Quarterly, 2023.

Feng, C., et al. (2020). Predictive Maintenance for Building

Components. International Journal of Building Pathology

and Adaptation, 38(1), 72-86.

Geissdoerfer, M., et al. (2020). The Role of Regulation

in Circular Economy Transitions. Journal of Cleaner

Production, 253, 119884.

Ghoreishi, Malahat, & Happonen, Ari (2020). New

Promises AI Brings into Circular Economy Accelerated

Product Design: A Review on Supporting Literature.

E3S Web of Conferences, Vol. 158, 06002. DOI: 10.1051/

e3sconf/202015806002.

Gupta, Nishika (2018). „A Literature Survey on Artificial

Intelligence.“ International Journal of Engineering Research

& Technology (IJERT), Vol. 5, No. 19. Available: IJERT.

Happonen, A., & Stepanov, A. (2015). Feasible Application

Area Study for Linear Laser Cutting in Paper Making

Processes. Physics Procedia, Vol. 78, 174-181. DOI:

10.1016/j.phpro.2015.11.03061.

Happonen, A., et al. (2009). Role of Logistics Service

Provider in Supply Chain Between Manufacturer and

Subcontractor. International Symposium on Logistics (ISL

2009).

Jatin Pal Singh. How AI and Machine Learning Are

Transforming the Circular Economy. World Economic

Forum.

Kalmykova, Y., et al. (2018). Circular Economy – From

Review of Theories and Practices to Development of

Implementation Tools. Resources, Conservation &

Recycling, 135, 190–201.

Kaza, Silpa, Yao, Lisa, Bhada-Tata, Perinaz, & Van Woerden,

Frank. What a Waste 2.0: A Global Snapshot of Solid

Waste Management to 2050. Washington, DC: World Bank

Publications, 2018.

Kirchherr, J., et al. (2018). Barriers to the Circular Economy:

Evidence from the European Union. Ecological Economics,

150, 264–272.

Kortelainen, H., et al. (2019). From Asset Provider to

Knowledge Company: Transformation in the Digital Era.

Lecture Notes in Mechanical Engineering, 333–341.

Li, B., et al. (2017). Applications of Artificial Intelligence

in Intelligent Manufacturing: A Review. Frontiers of

Information Technology & Electronic Engineering, 18, 86.

DOI: 10.1631/FITEE.1601885.

Murray, A., et al. (2017). The Circular Economy: An

Interdisciplinary Exploration of the Concept and

Application in a Global Context. Journal of Business Ethics,

140(3), 369–380.

Olivia Bartolini. No More Waste: 10 Ways to Incorporate the

Circular Economy into an Architectural Project | ArchDaily.

Porter, M. E., & Heppelmann, J. E. (2014). How Smart,

Connected Products Are Transforming Competition.

Harvard Business Review.

Prioux, N., Ouaret, R., Hetreux, G., & Belaud, J.P. (2023).

Environmental Assessment Coupled with Machine

Learning for Circular Economy. Clean Technol. Environ.

Policy.

Ramadoss, Tamil Selvan, Alam, Hilaal, & Seeram,

Ramakrishna (2018). Artificial Intelligence and Internet

of Things Enabled Circular Economy. The International

Journal of Engineering and Science, Vol. 7, No. 9. DOI:

10.9790/1813-0709035563.

Salmela, E., & Happonen, A. (2009). Role of Logistics

Service Provider in Supply Chain Between Manufacturer

and Subcontractor. ISL 2009 Proceedings.

Sitra (2018). Circular Economy Business Models for the

Manufacturing Industry.

Stankovic, M., et al. (2017). Industry 4.0: Opportunities

Behind the Challenge.

The Manufacturer (Annual Manufacturing Report), 2020.

UN FAO (2011). Global Food Losses and Food Waste:

Extent, Causes and Prevention.

Usama Awan, et al. (2021). Artificial Intelligence for Supply

Chain Success in the Era of Data Analytics. Studies in

Computational Intelligence, Vol. 935.

Van den Berg, M. R., & Bakker, C. A. (2015). A Product Design

Framework for a Circular Economy. PLATE Conference

Proceedings.

Waughray, D., et al. (2018). Harnessing the Fourth Industrial

Revolution for the Earth. World Economic Forum.

Zhong, R. Y., et al. (2017). Intelligent Manufacturing in the

Context of Industry 4.0: A Review. Engineering, 3, 616.

Zhou, Z. H. (2021). Machine Learning. Springer Nature:

Berlin/Heidelberg, Germany.

ARTICLES


63

Article

Façade Performance and Architectural Design

Sara Hemmatyar 1


Abstract

Contemporary architectural façade design elements combine both visual with operational requirements,

creating solutions which promote sustainable practices together with energy efficiency and comfortable

experiences. This paper summarizes part of the content acquired in the module MID 1040 during the Winter

Semester 2024-2025, describing façade applications regarding acoustics, solar shading systems, and thermal

performance. The paper highlights how key aspects of building physics must be combined for producing

sustainable energy-efficient buildings. The integration of multiple functions leads to better outcomes for

building users and protects the environment. Façade design becomes successful through methods which

merge functionality with sustainability while keeping aesthetics in the forefront.

Keywords: façade design, sustainability, acoustic performance, solar shading, thermal performance

1. Introduction

In contemporary architecture, façades have a

significant role in most projects. That is why the

design of façades play a significant role in the

transition from the internal space of the building to

the outer environment. Façades not only enhance the

quality of spaces for occupants to feel comfortable

and satisfied, but they also operate as a key factor

in environmental protection as well as enhancing

energy efficiency.

This article presents part of the content acquired in

the module MID 1040: Sustainability, Climate, and

Comfort, led by M.Eng. Alvaro Balderrama, Dipl.-

Ing. Manfred Starlinger, and Prof. Daniel Arztmann.

The main assignments of the course were a detailed

report of the semester in written format and a

poster that illustrated the concepts discussed. The

module covered key aspects of building physics and

sustainability such as acoustics, solar shading, and

thermal efficiency. Further topics from the course

such as moisture protection and visual quality were

left out of the scope of this summary. This paper

gathered information from some of the case studies

and workshops.

2. Acoustics in Architecture

Acoustics is an essential consideration in

architectural design, directly influencing the comfort,

functionality, and sensory experience of indoor and

outdoor spaces. Addressing aspects such as room

acoustics parameters, façade sound transmission,

and outdoor acoustic implications, architects can

create environments that enhance well-being and

meet the unique requirements of each space.

64

ARTICLES


Furthermore, soundscape perception is shaped by

a variety of contextual factors, making the study

of acoustic perception a multidisciplinary field that

extends beyond traditional sound management

(Aletta, Kang, & Axelsson, 2016). Contemporary

architecture requires acoustics to become a central

focus because urban noise pollution problems

continue to grow.

Façade acoustics examines sound behavior patterns

across various spaces together with the properties

of building elements. Façade design enables the

reduction of unwanted noise and can improve

comfort around the building. The rising density of

cities requires architects to find innovative ways of

combating noise pollution in order to make urban

environments habitable. The design of an optimal

façade contributes to better life quality through

sound control measures, thus acoustic performance

emerges as a fundamental element for creating

sustainable urban environments.

2.1. Acoustic Challenges and Solutions

in Urban Design

In urban areas, the predominant sounds are

from technology and people, including traffic,

construction, and industrial work. Urban noise

pollution is a growing concern in modern cities.

It significantly impacts residents‘ well-being and

requires innovative noise mapping and mitigation

strategies (Aletta et al.,2018). Noise pollution can

have dangerous effects on people’s health, including

stress, impairing sleep, and harming cognitive

functions. To cope with these effects, architects and

urban planners use noise mapping, a technique that

estimates the sound levels in defined regions. Also,

Nature-Based Solutions (NBS) such as green walls,

rooftop gardens, and ponds can also be utilized

to restore the city‘s soundscape and mitigate the

amount of urban noise. These efforts lead to better

mental health, improved cognition, and increased

sustainability for urban areas.

2.2. Acoustic Performance in Façades

Façades also function as sound barriers regulating

the transmission of sound from outside to indoor

environments. Airborne sound insulation may be

among the most crucial properties of façade acoustics

that can exclude sound from passing through into

buildings. In terms of the Sound Reduction (Rw),

airborne sound insulation expresses how efficiently

a material can obstruct the transmission of sound in

decibels (dB). The performance of a façade depends

on material selection, glazing, composite panels, and

insulation layers that are usually used to improve

sound insulation. By optimizing the mass, density,

and cavity design of the façade, architects can

maximize acoustic comfort for buildings. However,

outdoor considerations are also important since

reflective façades might improve indoor conditions

but harm the exterior. One example is a façade

system designed to absorb urban noise. Figure 2

shows a system that uses architectural ceramics

to reduce noise pollution effectively. The project

demonstrates how sustainable and innovative

façade designs can enhance urban living conditions.

It also shows how acoustic performance can be

integrated with broader sustainability goals. This

example illustrates the practical ways façades can

address urban noise challenges.

Figure 1. A noise map of Bochum, Germany. Image:

HS Gesundheit.

Figure 2. Sound absorbing façade material. Image:

Bartlett School of Architecture.

ARTICLES


65

Thoughtful design elements, such as using soundabsorbing

materials, geometric façade design,

and new noise-control technology, can contribute

significantly to urban acoustic comfort. Future

façade design must reconcile acoustic performance

with sustainability principles so that buildings not

only reduce noise pollution but also make the city a

more livable and efficient place.

Figure 5. Comparison of sound levels and perceived

loudness. Image by the author.

Figure 3. Rabel Aluminium Systems. Image:

ArchDaily.

2.3. Case Study: Agentur für Arbeit,

Paderborn

Technological sounds resulting from traffic and trains

dominate the environment whereas natural sounds

are scarce in the area. Neighborhoods with lower

noise levels present better perception than regions

with higher background sounds.

To analyze acoustic performance in real life, a study

was conducted on the Agentur für Arbeit office

building. Research on soundscape perception

through on-site surveys demonstrated that urban

noise pollution is substantial due to the location

being close to active transportation and the train

station.

Noise maps were created with the online tool

dBmap. The six points of measurement show the

sound exposure of the building with noise levels that

decrease as distance increases from these sources.

Figure 6. Sound source identification. Image by the

author.

Figure 4. Noise map of the building and 6 chosen

points with specific noise level. Image by the author.

High buildings and railway structures in the area

have weak sound-absorbing abilities that increase

noise reflection until it reaches maximum intensity

in proximity to transportation facilities.

3. Solar Energy in Architecture

Solar power is one of the most abundant and

renewable sources of energy, and it can reduce

the use of fossil fuels as well as carbon emissions.

Solar power directly influences building energy

efficiency by impacting heating, cooling, and

electricity production. In architecture, effective

incorporation of solar energy systems raises the

level of thermal comfort because artificial heating

and cooling requirements are reduced. Façades

are also significant in achieving maximum solar

gain through control of the amount of sunlight

penetrating a building. Solar radiation and shading

are vital parameters to consider in order to balance

66

ARTICLES


occupant comfort and energy efficiency.

3.1. Solar Geometry and Radiation

The amount of solar energy incident on a building

depends on its orientation, location, and geometry.

Solar angles such as altitude, azimuth, and

declination influence the intensity and duration of

sun exposure on a façade. Solar radiation includes

ultraviolet, visible, and infrared light, all of which

impact thermal performance and energy efficiency.

Cloud cover, season, and building form are influences

on the extent of solar energy absorbed, reflected, or

transmitted by surfaces. Understanding these helps

architects to design buildings that enable maximum

daylight with a minimum of unwanted heat gain,

contributing to comfort and sustainability.

Figure 8. Shading – Passive design strategies. Image:

National Energy Efficiency Building Centre (n.d.).

3.3. Solar Gains and Energy Efficiency

Figure 7. Solar radiation. Image: Penn State College

of Earth and Mineral Sciences (n.d.).

3.2. Solar Shading and Its Role in

Building Design

Shading systems are important to modulate solar

heat gain, energy conservation, and indoor climate

conditions. Different shading devices—external

shading devices (overhangs, louvers), internal

shading (blinds, curtains), and dynamic shading

(adjustable systems)—are implemented to manage

sunlight penetration. The effectiveness of shading

is quantified by utilizing the reduction factor (FC)

and g-value, which allows façades to offer sufficient

daylight without excess heat. Carefully designed

shading systems lower cooling loads in the summer

but also allow for passive solar heating in winter,

producing energy-efficient and climate-sensitive

buildings.

Solar energy contributes significantly to the thermal

performance of a building, and solar gains are

quantified as the amount of heat attained through

windows and façades. In cold climates, passive solar

heating design has the potential to reduce heating

loads by allowing sunlight to heat the indoor space

naturally. However, in tropical climates, excessive

solar gains lead to overheating and excessive cooling

loads. Solar Heat Gain Coefficient (g-value) quantifies

the quantity of solar radiation admitted through

glazing into a building. Solar gains are managed by

optimizing solar orientation, shading devices, and

glazing materials to attain higher energy efficiency.

3.4. Photovoltaic Systems

Photovoltaic (PV) devices convert sunlight to

electricity using semiconductor materials. PV

systems come primarily in two types: grid-connection

systems that are connected to the power system

and allow return of excess electricity, and standalone

systems independent with batteries that store

energy. Efficiency of the PV panel will depend on

the module type (monocrystalline, polycrystalline,

thin-film), the temperature, and exposure to

sunshine. Utilizing PV panels to building façades and

rooftops can enhance the energy self-supply while

constraining the reliance on traditional electricity

suppliers, hence becoming one of the essential

building sustainability components.

Figure 9. How do solar panels work? Image: SanTan

Solar (n.d.).

ARTICLES


67

3.5. Integrating Solar and PV Systems

in Architecture

Photovoltaic panel and solar energy system

integration in building design is of utmost significance

in an attempt to create energy-efficient architecture

and reduce the environmental footprint. Through

the integration of passive solar design, shading

strategies, and PV technology, buildings can optimize

electricity generation and daylighting. Designs of

the future have to be focused on smart shading

technology, enhanced PV materials, and adaptive

façades to construct adaptive climate and efficient

energy buildings. As cities grow, the use of solarpowered

technologies will be central to improving

sustainability, resilience, and reducing carbon

footprints in the built environment.

materials, i.e., walls, floors, and windows, thus making

insulation an essential element in minimizing thermal

loss. Convection arises when heat is transferred via

the migration of air, which may either occur naturally

due to ventilation or artificially using HVAC systems.

Radiation is the transfer of heat by electromagnetic

waves, including solar radiation that impinges on

exterior surfaces and enters interior spaces. With a

clear understanding of these processes, architects

and engineers can create façades that reduce

unwanted heat transfer while optimizing thermal

comfort and energy efficiency.

4. Thermal Energy in Architecture

Thermal energy is a fundamental aspect of building

physics, which emerges from particle kinetic activity

for indoor environment control to achieve comfort

while influencing energy costs. Temperature

measurements help building enclosure managers

achieve better comfort while sustaining green

protocols along with reduced heating or cooling

requirements. Renewable energy integration during

building development establishes enhanced thermal

comfort while raising energy performance without

creating substantial carbon emissions. Different

physiological factors including climate conditions and

individual behavior patterns and dressing choices

determine how people experience thermal comfort.

The indoor climate standards establish appropriate

environmental parameters that should satisfy 80%

of building inhabitants by maintaining temperatures

between 20-22°C and relative humidity between

35-70%. Natural ventilation combined with strategic

windows produces benefits for building thermal

comfort and energy efficiency.

Figure 11. Wall section. Image: Terraco (n.d.).

4.2. U-Value and Its Role in Thermal

Insulation

The U-value is a critical parameter for determining

the ability of building materials to transfer

heat; lower U-values indicate better insulation

performance. Materials with low U-values, such as

aerated concrete, mineral wool, and double-glazed

windows, reduce heat transfer considerably, thus

keeping indoor spaces warmer in winter and cooler

in summer. By selecting materials with low thermal

conductivity, architects can enhance the energy

efficiency of a building and its responsiveness to

changing climatic conditions. Lowering the U-value

of a building envelope contributes to a decrease

in heating and cooling expenses, lowers carbon

emissions, and provides a uniform indoor thermal

climate.

4.3. Enhancing Thermal Performance

Figure 10. Building thermal comfort analysis. Image:

Ecologikol (n.d.).

4.1. Heat Transfer Mechanisms in

Buildings

There are three fundamental mechanisms through

which heat transfer within buildings is achieved:

conduction, convection, and radiation. Conduction

refers to the transfer of thermal energy via solid

To improve thermal efficiency, designers can

integrate insulation, climate-responsive materials,

and passive solar strategies into façade design. A welldesigned

thermal façade not only reduces heating

and cooling costs but also enhances occupant

well-being by maintaining a comfortable indoor

climate. Sustainable design approaches should

focus on maximizing thermal insulation, managing

solar gains, and selecting energy-efficient building

materials. Future architectural innovations will rely

on smart façades, adaptive insulation technologies,

and energy-efficient glazing to create resilient, low-

68

ARTICLES


carbon, and thermally efficient buildings that align

with global sustainability goals.

4.4. Case Study: U-value Calculation of

Building #2

Figure 12. Building #2 of TH OWL in Detmold.

Figure 13. Assumption of façade units.

A calculation of the nominal value of the thermal

transmittance Ucw for curtain walls was conducted

per EN ISO 12631: 2017, using an excel table provided

by the instructor, as well as using the Building Physics

Solver online tool.

Landscape and Urban Planning. 149. 65–74. 10.1016/j.

landurbplan.2016.02.001.

Aletta, F., Oberman, T., & Kang, J. (2018). Associations

between Positive Health-Related Effects and Soundscapes

Perceptual Constructs: A Systematic Review. International

Journal of Environmental Research and Public Health,

15(11), 2392. https://doi.org/10.3390/ijerph15112392

Bartlett School of Architecture investigate. How do we

design our way out of urban noise pollution? Retrieved

[02.03.2025], from https://www.materialsource.co.uk/

how-do-we-design-our-way-out-of-urban-noise-pollutionbartlett-school-of-architecture-investigate/

Ecologikol. (n.d.). Building thermal comfort analysis.

LinkedIn. Retrieved from https://www.linkedin.com/pulse/

building-thermal-comfort-analysis-ecologikol/

HS Gesundheit. „Stakeholders Engagement in Noise

Action Planning Mediated by OGITO: An Open Geo-Spatial

Interactive Tool“. Retrieved from https://www.researchgate.

net/figure/A-noise-map-of-Bochum-Germany-Source-HS-

Gesundheit_fig1_370822692

National Energy Efficiency Building Centre. (n.d.). Shading

– Passive design strategies. NZEB Knowledge Centre.

Retrieved from https://nzeb.in/knowledge-centre/passivedesign/shading/

Pennsylvania State University. (n.d.). Energy from the sun:

Solar radiation. Penn State College of Earth and Mineral

Sciences. Retrieved from https://www.e-education.psu.

edu/meteo300/node/683

Rabel Aluminium Systems. (n.d.). Façade vertical folding

shading system - Rabel 14200. ArchDaily. Retrieved from

https://www.archdaily.com/catalog/us/products/26915/

façade-vertical-folding-shading-system-rabel-14200-

rabel-aluminium-systems

SanTan Solar. (n.d.). How do solar panels work? Retrieved

from https://www.santansolar.com/how-do-solar-panelswork/

Terraco. (n.d.). What is EIFS/ETICS? Retrieved from https://

www.terraco.com/tur/what-is-eifs-etics/

5. Conclusion

In the coming years, façade design will depend

more on efficient materials, and likely on innovative

technology such as dynamic shading systems,

and high-efficiency photovoltaics. As future cities

continue to develop, the use of environmentresponsive

and performance-driven façade

solutions will remain essential to the development of

sustainable architecture. Innovative and integrated

design solutions can allow architects and engineers

to develop façades that are in balance with their

environment and creating resilient cities.

6. References

Aletta, Francesco & Kang, Jian & Axelsson, Östen.

(2016). Soundscape descriptors and a conceptual

framework for developing predictive soundscape models.

ARTICLES


69

4. MID DESIGN CONCEPTS

70 ARTICLES


MASTER OF INTEGRATED DESIGN (MID)

DESIGN CONCEPTS

MID 1040: Sustainability, Climate and Comfort

MID Design Concepts

Lecturers: Alvaro Balderrama, Manfred Starlinger, Prof. Daniel Arztmann

The module MID 1040 (formerly MID S4) focuses

on providing an understanding of key principles

related to façade performance in terms of building

physics, as well as other aspects of sustainable

design, such as energy efficiency and human

comfort.

The semester was structured into six main parts:

(1) acoustic performance, (2) solar shading, (3)

energy efficiency, (4) thermal performance, (5)

moisture and hygiene, and (6) visual quality. To

address these topics, a series of lectures and

workshops were planned throughout the semester

to give students the theoretical background along

with hands-on experience using assessment tools,

calculation methods, and site visits.

Assignment 2: Poster Presentation

For the final presentation on January 29, 2025, each

student prepared two highly illustrative posters in

the specified format (vertical DIN A3). Students

were free to design the posters to support their

presentations; therefore, the use of an infographic

style was recommended. The posters were

expected to visually convey the main concepts

learned throughout the semester, accompanied

by short texts summarizing each of the six topics.

The 15 double-page posters are presented ahead.

Assignment 1: Semester Report

Throughout the semester, students were expected

to document their work by creating a written

report, with one chapter dedicated to each of the

main topics covered in the course. By the end of the

semester, they were to compile a comprehensive

document that could serve as a guide for future

projects. The final report followed the specified

format (vertical DIN A4, Arial 11 for body text, single

spacing), and included the following sections:

Cover Page, Summary, Introduction, Acoustic

Performance, Solar Shading, Energy Efficiency,

Thermal Performance, Moisture and Hygiene,

Visual Quality, and Discussion. The report was

submitted in digital format via upload to the Ilias

platform by January 24, 2025.

MID DESIGN CONCEPTS


71

Energy Efficiency in Building Design (PV-panels): Key Steps

• Energy demands of consumers and energy losses.

• Seasonality, panel positioning, geographical location, budget, roof size, orientation, and

inclination.

• Series, parallel, or hybrid configurations, solar panel type based on energy needs and shading

factors.

• Appropriate inverter based on system size and panel output. Central inverters or microinverters.

• Potential shading risks

• Manufacturing defects (e.g., microcracks, delamination).

• Grounding and surge protection devices.

Solar Analysis in Building Design: Key Steps

• The angle of declination, day length and latitude through the year, solar

altitude and azimuth angles, and solar intensity.

• Reflection, absorptance, and transmittance of solar radiation, secondary heat

delivery (the heat generated by absorbed radiation transferred to the interior).

• Vertical and horizontal shadow angles (VSA and HSA), Shading Coefficient

(SC), external shading, internal shading, dynamic shading systems or

photochromic glass.

• G-values.

• DIN EN ISO 52022, DIN 4108-2.

Moisture in Building Design: Key Steps

• Internal moisture sources and external moisture sources.

• Indoor air does not cool to the dew point.

• Properly insulate thermal bridges.

• Uniform heating across the building.

• Unobstructed air circulation, especially on exterior wall surfaces.

• Temperature factor (f Rsi ) to verify the temperature difference between surfaces and air.

• Interior conditions of +20°C and 50% relative humidity. Exterior conditions of -5°C and

80% relative humidity.

• DIN 4108-2, the German Energy Saving Ordinance (EnEV).

Anastasiia Krasnikova

72

MID DESIGN CONCEPTS


Acoustic Analysis in Building Design:

Key Steps

• Project requirements and sound sources (e.g.,

traffic, machinery, environmental).

• Façade materials based – reflection, absorption,

and transmission coefficients.

• Tools – Grasshopper and Pachyderm Acoustics

for acoustic simulations.

• EN ISO 10140-2, DIN 4109-1:2018, ISO 12913.

The visual quality in

Building Design: Key

Steps

• Objective and subjective

preferences.

• Analysis of design elements

like symmetry, proportion,

and materials.

Thermal Efficiency in Building Design: Key Steps

• Thermal comfort for occupants, air temperature, surface temperature, humidity, and air velocity, types of

heat transfer: conduction, convection, and radiation. Minimize heat loss.

• U-value for the window frame, glazing, panels, and spacers (linear thermal transmittance).

• Software tools for thermal simulations - Schücal, Therm, Flixo.

• DIN EN ISO 10077-1/2 and DIN EN ISO 12631.

Refer to the report or the page attached to the poster for all image sources.

Auth. Krasnikova Anastasiia

MID DESIGN CONCEPTS


73

Aashish Singh

74

MID DESIGN CONCEPTS


MID DESIGN CONCEPTS


75

MID 1040 Sustainability, Climate and Comfort

The way people perceive,

experience, and react to the

entire spectrum of sounds in a

location at a specific moment

is referred to as the

"soundscape."An emerging

field called "soundscape

studies" aims to take a

listener-centered approach to

the problem of urban acoustic

environments. Context desired

rather than unwanted sounds,

and personal preference over

discomfort are the main points

of emphasis for the

soundscape approach.

The decibel (dB) is a

relative unit of

measurement, widely

used in acoustics. The

dB is a logarithmic ratio

between the measured

level and a reference

(threshold) level of 0 dB.

Various dB-level

measurement apps

have been developed.

Instruments that are

lab-calibrated can be

used to measure the

exact dB levels of any

surroundings.

ACOUSTIC ENHANCEMENTS:

SOUND REDUCTION TECHNIQUES

PPPPPP HHHHHH PPPPPPPP UUU

Bishal Sunar

76

MID DESIGN CONCEPTS


The term 'thermal performance' generally relates to the efficiency

with which something retains or prevents the passage of heat.

Various factors are considered to measure the thermal

performance of the building. They can be listed as follows

The sense of comfort or

well-being of a person

contributes significantly to the

person’s health and productivity.

Thermal comfort is subjective,

which means that not everyone

will be equally comfortable

under the same conditions.

PLANNING AND SIZING OF GRID-TIED PV SYSTEMS

Many common moisture problems can be traced to poor decisions

in design, construction, or maintenance.Moisture control consists

of:

Preventing water intrusion and condensation

Limiting the areas of a building that are routinely wet and drying

them.

EXAMPLES OF COLD BRIDGES

COMMON CAUSES OF COLD BRIDGES

• High Thermal Conductivity Materials

• Structural Elements

• Inadequate Insulation

MID DESIGN CONCEPTS


77

Erik Karimov

78

MID DESIGN CONCEPTS


MID DESIGN CONCEPTS


79

M I D 1 0 4 0 : S U S T A I N A B I L I T Y , C L I M A T E A N D C O M F O R T

E S R A A A H M E D

PAST

B U I L D I N G P H Y S I C S

Hotter air is

expelled

through the

upper slats

Reflected

Direct

solar Rays

Air flow

geometric tile patterns and

carved calligraphy, which

diffuse sound and reduce

echoes. Their textured

surfaces break up sound

waves, improving speech

clarity in large prayer halls.

Thatched roofs with deep

overhangs in African

architecture provided

natural shade, reduced

heat gain, and kept

interiors cool, showcasing

sustainable design suited

to hot climates.

S O L A R S H A D I N G

The Mashrabiya

Provides shade by

blocking direct sunlight

while allowing

ventilation and filtered

light into interiors.The

Alhambra Palace in

Spain

Hot Air at

the Top

Cool Air at

the bottom

High Domes and Ceilings

Mosques often feature

large central domes that

amplify and evenly

distribute sound

throughout the prayer

hall. The dome design

reduces echo while

ensuring that the imam's

voice reaches the

congregation clearly.

süleymaniye Mosque in

Istanbul

A C O U S T I C S

Heavy masonry walls

were an effective

traditional method for

soundproofing buildings.

These thick stone walls

provided natural

insulation, reducing the

transmission of external

noise into the interior

spaces.

V I S U A L Q U A L I T Y

Visual quality in buildings was

achieved through craftsmanship,

natural materials, symmetry, and

thoughtful design, creating

harmonious and meaningful

spaces that blend with the

environment.

T H E R M A L

P E R F O R M A N C E

Al Malgaf encourages

natural airflow by creating a

shaded space with openings

that allow cool air to circulate

through the building

The wooden or palm-frond

construction of Al Malgaf

absorbs and disperses heat

gradually. It acts as a

thermal barrier, preventing

excessive heat from entering

the building.

M O I S T U R E A N D

H Y G I E N E

Natural ventilation was

achieved by opening

windows, which frequently

led to drafts and limited the

ability to effectively manage

moisture, impacting indoor

air quality and hygiene.

Traditional buildings used

thick walls made from

mudbrick, stone, or clay to

act as a physical barrier,

slowing down moisture from

entering indoor spaces.

E N E R G Y

E F F I C I E N C Y

In traditional Arabian architecture,

energy efficiency was achieved

through the use of courtyards,

green plants, and water features.

These elements provided natural

cooling, shading, and ventilation,

reducing heat gain and stabilizing

indoor temperatures. This passive

approach minimized energy

consumption, creating a sustainable

and comfortable living environment

without relying on external energy

sources.

Esraa Ahmed

80

MID DESIGN CONCEPTS


Acoustics

Sound-absorbing materials

(eco-friendly panels, wood).

Glass facades & green walls

reduce echo and city noise.

M I D 1 0 4 0 : S u s t a i n a b i l i t y , C l i m a t e a n d C o m f o r t

E s r a a A h m e d

PRESENT

S U S T A I N A B L E A R C H I T E C T U R E

Location:

Amsterdam, Netherlands

Awards:

BREEAM Outstanding (98.36%),

LEED Platinum

World Green Building Council Award

Net-Positive Energy:

Produces more energy

than it consumes

The Edge, Amsterdam

Solar Shading

Automated shading system &

triple-glazed windows adjust

based on sun position.

Building orientation optimized

for passive solar control.

Solar heat

reflected out

Low E coating

thermal insolation

Winter warmth

reflected back inside

Natural light

passes through

Thermal Performance

underground thermal storage

Geothermal heating & cooling system

Automated ventilation & thermal mass

concrete flooring

Energy Efficiency

Solar panels covering facade & rooftop

→ generates more power than needed.

AI-controlled smart LED lighting &

energy monitoring.

Thermal mass

concrete flooring

Visual Quality

Glass facade for natural daylight

(reduces artificial lighting need).

Biophilic design (green walls,

open spaces for well-being).

130 m

Moisture and Hygiene

Rainwater harvesting for toilets &

irrigation.

CO₂-controlled air filtration system

Sustainable Development Goals

1. Clean Energy (SDG 7): 100% renewable

power.

2. Innovation (SDG 9): IoT sensors

optimize efficiency.

3. Sustainable Cities (SDG 11):

BREEAM-certified, water-saving

systems.

4. Responsible Consumption (SDG 12):

Eco-friendly materials.

5. Climate Action (SDG 13): Smart

shading & thermal mass regulate

temperature

MID DESIGN CONCEPTS


81

Kavyashree Govil

82

MID DESIGN CONCEPTS


MID DESIGN CONCEPTS


83

Mansi Aggarwal

84

MID DESIGN CONCEPTS


MID DESIGN CONCEPTS


85

AUDITORY SCALE

The human auditory range

spans from 20 Hz to 20,000

Hz, covering frequencies

that the average ear can

perceive. Below 20 Hz lies

infrasound, which is more

often felt than heard, while

frequencies above 20 kHz

are classified as ultrasound.

Ultrasound is generally

inaudible to humans but is

used by certain animals for

communication and

navigation

SITE CONDITIONS

The project is located in the heart of Beirut, few

meters away from the coastal line and the busiest

highway connecting the north part of the Lebanese

Capital to its southern part.

PROPOSED TRIPLE GLAZING COMPOSITION

MID1040 Sustainability, Climate and Comfort - WinSe 24-25

Prepared by: Marie Al Helou 20135939

Supervised by: Alvaro Balderrama, M.Eng., Dipl.-Arch., LEED

CLIMATE & COMFORT

In facade design, climate

and comfort play a vital

role in creating indoor

environments that are

both pleasant and

energy-efficient. A wellthought-out

design takes

into account thermal

comfort, natural lighting,

acoustic performance,

and responsiveness to

occupants' needs, all

while prioritizing energy

SOUND REFLECTION ON GLASS

SURFACES

When sound waves strike a glass surface,

they are reflected back. The extent of this

reflection is influenced by factors such as

the angle of incidence, the thickness of the

glass, and the presence of coatings.

Smooth glass surfaces, in particular, tend to

reflect more sound, thereby increasing noise

levels in the surrounding environment.

FAÇADE PHOTOS AFTER INSTALLATION

VEGETATION

The vegetation surrounding the building

acts as an acoustic buffer, reducing noise

levels while allowing fresh air to flow into

the proposed structure. Additionally, it

influences and alters the microclimate

around the building

FRONT FAÇADE ELEVATION

Marie Al Helou

86

MID DESIGN CONCEPTS


VENTILATION:

In summer, strategically

positioned vents allow warm air

to rise and escape, preventing

overheating, while operable

windows regulate cool air flow

to reduce heat. In winter, vents

help direct the upward flow of

warm air, promoting natural

ventilation and maintaining a

comfortable

indoor

environment. Opening operable

windows further enhances fresh

air circulation, improving air

quality and reducing the need

for mechanical systems.

SHADING

Corten steel fins are integrated into the

curtain wall system, both vertically and

horizontally, serving as shading elements to

enhance comfort for the building's occupants

behind the glazed façade.

THERMAL PERFORMANCE

The U-Value and Solar Shading

Coefficient (SC) must comply with

EN673 and must not exceed

U-value 2.0 W/m2.K

SC : 0.4

External Climate Characteristics:

• Summer Time Dry Bulb: 35°C

• Winter Time Dry Bulb: 5.6°C

• Summer Time Wet Bulb: 26.7°C

• Summer time Relative Humidity: 80%

Internal Climate Characteristics:

• Summer Time Dry Bulb: 23.8°C

• Winter Time Dry Bulb: 21.1°C

• Summer time Relative Humidity: 50%

The Sustainable Development Goals (SDGs)

are political objectives established by the

United Nations to promote sustainable

development on a global scale. Comprised of

17 goals, they address the three core

dimensions of sustainability: social,

environmental, and economic. These goals

are designed to be achieved by all nations,

both in the Global North and Global South,

by 2030. The SDGs are interconnected and

indivisible, emphasizing their mutual

dependence for comprehensive progress.

Bibliography

https://www.nps.gov/subjects/sound/rm47-1-

introduction.htm

https://www.hollyland.com/blog/tips/what-is-db

www.ibecegroup.com

UN Sustainable Development Goals

https://www.alamy.de/larmbelastigung-urban-noisethemen-und-konzepte-wort-cloud-abbildung-wortcollage-konzept-image265165649.html

https://www.glassonweb.com/article/industrializationand-thermal-performance-new-unitized-water-flowglazing-facade

MID DESIGN CONCEPTS


87

SOLAR SHADING

Solar shading devices are crucial components in building

design for improving thermal comfort and energy efficiency.

MID 1040 : SUSTAINABILITY, CLIMATE AND COMFORT

WINTER SEMESTER | 2024-2025 | NITESH SHRESTHA

ACOUSTIC PERFORMANCE

Acoustic performance of facades refers to their ability to

reduce sound transmission from the exterior to the interior or

from interior to interior of a building, thereby enhancing indoor

acoustic comfort.

Fig : Different types of shading devices.

SOLAR GEOMETRY

Solar geometry refers to the position and movement of the

sun relative to a specific location on Earth.Key component are

1. Solar Altitude Angle

2. Solar Azimuth Angle

Fig : Transmittance of sound

COMPOSITION OF WALL FOR BETTER ACOUSTIC

SOLAR CHART DIAGRAM

A solar diagram is a graphical representation of the sun's

position in the sky throughout the year for a specific location.

AMBIENT NOISE LEVEL

Fig: Wall Section showing

The totality of all sounds within the room when the room is

unoccupied.

URBAN SOUNDSCAPE

Fig: Noise coming in Room

Urban soundscape refers to the acoustic environment of a city

or urban area as perceived and experienced by people in

context, including both natural and human-made sounds.

INTERACTION OF SUN WITH BUILDING ENVELOPE

Reduction factor F

0.1 < F

C < 0.4

Fig: Solar chart Diagram

Shading Coefficient S

C = g window / g 4mm float

Total energy transmission

value / SHGC

total ~ g window * F C

Fig: Soundscape of a lively urban square

Nitesh Shrestha

88

MID DESIGN CONCEPTS


ENERGY EFFICIENCY

Energy efficiency refers to the ability of a building's exterior

envelope to minimize energy consumption while maintaining

indoor comfort.

1. BIPV CELL

BIPV refers to photovoltaic modules integrated directly into

the building envelope (e.g., roofs, façades, skylights), serving

dual functions as structural components and power

generators.

FACADE THERMAL PERFORMANCE

Façade thermal performance is a critical aspect of building

design that significantly impacts energy efficiency, occupant

comfort, and overall sustainability.

Fig : Thermal Energy

HEAT TRANSFER COEFFICIENT (U-VALUE)

The U-value describes the heat flow (in watts) through one m²

of a structure in one hour, divided by the difference in

temperature in K across the structure. It is expressed in watts

per square meter kelvin [W/m²K].

Fig : Composition of BIPV

2. DAYLIGHTING

Day lighting is the use of natural light in the interior of a

building and this element tends to minimize the use of artificial

light. It not only improves visual comfort but also has

advantages in energy consumption and persons using the

buildings.

HEAT TRANSFER

Heat transfer in buildings occurs through three main

mechanisms: conduction, convection, and radiation.

Fig : Daylighting

Fig : Heat Transfer in building and window

Fig : Adjustable Shading Devices

Fig : Thermally Broken window

Fig : NonThermally Broken

window

MID DESIGN CONCEPTS


89

“Sustainability,

Climate and Comfort”

Acoustic

Lecturer: Alvaro Balderrama

Author : Sara Hemmatyar

Winter semester 2024-2025

Acoustic performance plays a vital role in ensuring comfort and functionality within a building.

Doors and Windows

Doors and windows are critical for

soundproofing.High-performance

acoustic doors and double or triple-glazed

windows with proper seals

block noise leakage effectively.

Insulation Layer

The insulation material within the walls

provides excellent sound absorption, reducing

airborne noise and preventing it

from traveling between rooms or from

outside to inside.

Floor Assembly

The wooden beams in the floor

structure allow for the integration

of acoustic underlays or resilient

layers, minimizing both impact

and structural noise.

Wall Design

Double-layered walls with integrated

insulation serve as barriers

that dampen sound vibrations

and enhance acoustic comfort

within spaces.

Mineral Wool

Reduction:

Approximately 25-

35 dB, depending on

thickness and density.

Materials which helps sound reduction

Acoustic Solid-Core Door:

specifically for soundproofing,Achieves

STC 35–40,

effectively blocking louder

sounds like shouting or music

Double glazing window with

Acoustic Laminated Glass:

reduce heavy traffic noise

(80 dB) to around 35 dB

indoors, providing excellent

comfort.

Solar Panels

SHADING PANELS

Solar panels and shading panels are a sustainable energy solution for residential buildings,

contributing to energy efficiency and environmental responsibility.

Monocrystalline Panels

&

2.1 m

1 m

Capable of reducing

electricity bills by

60%–80%

south-facing

Efficiency

15%–22%

A typical residential solar panel

system annually generates approximately

4,000–5,000 kWh

30°–45° roof slope in the

northern hemisphere

Allow controlled sunlight

to entr.

Aluminium

Wood

Minimize overheating in

summer

Adjustable

Reduce energy demand

for air conditioning up to

30%

It could be installd everywhere in the

house with specific consideration for

each part

Sara Hemmatyar

90

MID DESIGN CONCEPTS


“Sustainability,

Climate and Comfort”


Author : Sara Hemmatyar

Winter semester 2024-2025

Thermal Performanace

Heat Protection

Heat Transmission

Use of external

shading

High-performance insulation

materials

Properly sealed windows and doors to minimize air

leakage.

Low-E glazing to reflect solar radiation while maintaining

daylight.

Walls, roofs, and floors

with low U-values

Use of multi-layered construction with

thermal insulation layers.

Double or triple-glazed windows to reduce

heat transfer.

Airtight construction to prevent convective heat

loss.

Long wave

lenght of

sun

Visible

light

Exterior

Radient heat

Interior

Cold Bridges

Moisture Protection

Detailed design around

windows, doors, and

balconies to prevent

thermal bridging.

Insulation continuity to avoid

gaps at junctions (e.g., between

walls and roofs).

Use of vapor barriers to control

moisture movement.

Proper drainage systems to prevent

water accumulation around

the foundation.

Materials with high permeability

for exterior walls to allow moisture

escape.

Regular maintenance of sealing

around windows and doors to

prevent leaks.

Continiuty of insulation and

Fill voids

Thermal break materials in structural elements.

MID DESIGN CONCEPTS


91

SOUND SCAPE

a combination of all the sounds perceived in an

environment ,

INDOOR SOUND SCAPE.

characterized by a combination of sounds

from both internal and external

sources,

RADAR PLOT

Sustainability ,Climate and Comfort

FACADE ACOUSTICS

concerns the ways in which buildings can control sound for

comfort and the well- being of occupants. It encompasses

discussion on ambient acoustics, noise control strategies, and the

betterment of urban soundscapes by means of architecture.

Source: Spatial aspects in urban soundscapes: Binaural

parameters application in the study of soundscapes

from Bogotá-Colombia and Brasília-Brazil

SOUND ABSORPTION BY FACADES

the ability of materials to transform sound energy

into a tiny amount of heat.

Different façade materials have varying

absorption coefficients, which measure their ability to

absorb sound

https://yunchuliang.com/City-

Soundscapes

REVERBATION TIME

The reverberation time T60 measures the time taken for the

sound pressure level to decay by 60 dB when a sound stops.

R=L1−L2+10log(S/A)

SOUND INSULATION

• Wall insulation/density

• Cavities/double walls •

Acoustic glazing •

WEIGHTED SOUND REDUCTION INDEX (Rw) Acoustic laminates •

an acoustic rating used to measure and indicate the effectiveness of Acoustic sashes

a soundproofing material, wall, or system

ACOUSTICS AND SOUNDSCAPE IN THE SDGs

ACOUSTICS IN ARCHITECTURE

Vegetated façades can decrease sound levels

Noise map for a densely populated city

Source :MID - Sustainability, Climate and Comfort –

Alvaro Balderrama, 2024

Wall Sound Insulation Diagram

FAÇADE'S IMPACT ON INDOOR Source: https://www.ikoustic.co.uk/science-soundproofing

SOUND PERCEPTION AND QUALITY

Vegetated façades can decrease sound levels A building's exterior has a big impact on

Source:Boston Society for Architecture

indoor sound quality and perception. It acts as

a partition between the inner space and outside

sounds. Important elements consist of:

• Sound Insulation: By reducing outside noise,

materials like insulated walls and doubleglazed

windows enhance indoor comfort.

porous façades absorbing sound,

especially high frequencies

source:Mavro International

ENERGY

emphasizes the potential of renewable energy and solar

technologies in meeting energy demands sustainably.There are

two types of energy mainly heat and work .

RENEWABLE ENERGY

• Reflection and Diffusion: The facade's

materials and design can have an impact on

how sound enters the building and is reflected

or absorbed, which can alter reverberation and

echo.

• Ventilation: Noise may enter through

openings. acoustic windows also aid in sound

reduction.

• Effect on Perception: By lowering outside

noise, a well-insulated facade improves inside

comfort, lowers stress levels, and improves

speech clarity.

Classification of methods for solar energy utilization

source:

Acoustical Evaluations of a Double Skin Façade as a Noise Barrier

of a Naturally-Ventilated Facade

Acoustic glazing

source:https://www.prestonglassfix.co.uk

Interspatial Acoustics

• Environmental Acoustics

• Façade Acoustics

• Room Acoustics

• Mechanical Acoustics

source:https://building-acoustics.net/environmental-acoustics/

SOFTWARE

TOOLS

SCHÜCAL

TZ EXCEL TOOL

BP SOLVER

(BUILDING

PHYSICS

SOLVER)

APPLICATION IN SOLAR ENERGY SYSTEMS

1.Paraboloid concentrating collector

2Cylindrical parabolic concentrating collector

3..Flat-plate collector

4.Solar air heater

5.Solar water heater

1.Paraboloid concentrating collector

Source:Environmental Science and Pollution Research

3.Flat-plate collector

Source: Experimental investigation on a flat plate solar collector using Al2O3

FAÇADE VISUAL QUALITY

he façade is an important aspect in determining a building's aesthetic identity and influences the

overall visual appeal of urban surroundings. A well-designed façade contributes to the development of

human-centered cities, which improve the quality of life for both residents and visitors

4.Solar air heater

Cylindrical parabolic concentrating collector

Source:Parabolic trough solar collectors: A general overview of

technology, industrial applications, energy market, modeling, and

standards.

AUTHOR :SYLIVIA KANYORA

GSPublisherVersion 0.0.100.100

Source:Multi-criteria design methods in façade engineering: State-of-the-art and future trends

Sylivia Kanyora

92

MID DESIGN CONCEPTS


Source: https://nzeb.in/knowledgecentre/passive-design/shading//

Solar angles

Source :solar radiation simulation

device for investigation of thermal and

photovoltaic cells

The solar direction of a given building facade will determine

the design of efficient shading devices. For instance, when

sun angles are strong in the summer, simple fixed overhangs

work wonders in shading windows facing south.

Nevertheless, during the summer's periods of greatest heat

uptake, the same horizontal device is useless at keeping the

low afternoon sun from reaching west-facing windows.

Sustainability ,Climate and Comfort

SOLAR SHADING

The term "solar shading" describes the use of several architectural

strategies and tools to regulate how much sunshine or solar

radiation enters a building. The objective is to minimize the

energy needed for heating while controlling the amount of heat

gained from the sun, optimizing daylighting, and enhancing

indoor comfort.

Source :A Study on Shading of Buildings as a Preventive Measure for Passive Cooling by

Mohammad Arif Kamal

Source:https://basc.pnnl.gov/images/sources-heat-gain-house-include-solar-gains-infiltration-

.Composition of global radiation

conduction-through-walls-and-roof

The total amount of solar energy received by a horizontal Heat gains in a building refer to the increase in temperature within a

surface is referred to as global radiation. It

space caused by various sources of heat. These gains can greatly effect a

is made up of three parts:

building's energy efficiency and comfort levels.

PHOTOVOLTAICS FOR

PROFFESIONALS

Photovoltaics (PV) refer to the technology that converts sunlight directly into electricity using solar

cells.

Connection of PV modules

wiring solar panels of different ratings in series

Wiring solar pv panels in parallel Mixed wiring of solar panels

Source:https://bushenergy.com.au/pages/mixing-solar-panels

Parts of a PV System

l Solar Modules: Arrays of interconnecting solar

cells encased in protective materials. l Inverters

convert direct current (DC) from photovoltaic

modules to alternating current (AC) for

usage in homes or grids. l The Balance of System

(BoS) comprises mounting structures, cabling, and

monitoring equipment.

Types of PV Systems

l. Grid-Tied means connected to the electrical

grid.Excess energy can be put back into the grid,

usually with incentives. l Stand-Alone: Operates

independently from the grid, typically with

batteries.Suitable for distant

areas. l Hybrid systems:Combine PV with other

energy sources (such as wind and diesel) or storage.

Types of PV Systems

FACADE THERMAL PERFORMANCE

Thermal comfort is a subjective state of satisfaction with the thermal environment in which anindividual does not feel overly hot or cold. ISO 7730 defines it as "the state of mind that

expresses satisfaction with the thermal environment."

Influencing factors:

l Air temperature

Mean radiant temperature.

Air speed,

relativehumidity.

Metabolic rate (activity level).

Clothing Insulation

Uw Value (Window)

The U⒲ value is the heat transfer

coefficient of a window

HEAT TRANSFER COEFFICIENT (U – VALUE)

Cold bridges

MOISTURE AND

COLD BRIDGES

Thermal Bridge

Allowance: EnEV

recommends

a thermal bridge

allowance (ΔU) of 0.05

W/(m²K) for

high-performance joints

and 0.10 W/(m²K) for

regular joints.

AUTHOR :SYLIVIA KANYORA

GSPublisherVersion 0.0.100.100

Thermal comfort factors and their effects.

Source:https://www.researchgate.net/figure/

Thermal-comfort-factors-and-their-effects_fig1_365499413

Sections of a building

where thermal bridging

causes heat loss, leading

to serious energy waste

&discomfort problems.

The isothermal analysis, shown on the right, reveals temperature

gradients. The isotherms show a significant temperature drop near

the connecting point, with the lowest recorded surface temperature

being 7.2 °C. This cold bridge develops due to material conductivity

and structural design, which allows heat to

Moisture Sources and Effects in Buildings

escape more easily through certain locations.

Source :MID - Sustainability, Climate and

Comfort – Alvaro Balderrama, 2024

thermal bridges and their impact on buildings

https://tools.bregroup.com/certifiedthermalproducts/

page.jsp?id=3073

MID DESIGN CONCEPTS


93

The semester poster discusses sustainability,

climate, and comfort in architecture. It contains

seven themes, each of aspects demonstrates

how technologies such as photovoltaic systems

and green facades enable human-centered,

sustainable design. The poster calls for green

architecture with a picture of a potential green

building. The poster focuses on the necessity

for flexible, resilient, and sustainable designs

that meet human and environmental demands.

ACOUSTIC

PERFORMANCE

Noise pollution control enhances occupant

comfort and productivity. Noise transmission is

minimized by strategic design and sound insulation

materials.

Sustainability, Climate, and Comfort: Win

Envisioning Green Architecture for a

ENERGY

EFFICIENCY

Low-energy buildings minimize operational energy

consumption, setting the stage for a sustainable

future. The major drivers are insulation, renewable

energy, and smart systems.

Energy Use (kWh)

200

175

150

125

100

75

50

25

Heating / Cooling Lighting Appliances

Energy Categories

Before Efficiency

Measures

After Efficiency

Measures

Other

Acoustic Absorption Coefficient

1

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0

Solar panels, being one

of the leading renewable

energy technologies,

harness the energy of the

sun to generate electricity,

reducing the consumption

of fossil fuels. Coupled

with proper insulation

and effective thermal

control, they significantly

lower the energy profile

of a building while

enhancing sustainability.

125 250 500 1k 2k 4k

Frequency (Hz)

6mm 10mm 15mm 20mm 25mm 50mm

Green buildings of the future promote acoustic

insulation through triple glazing, acoustic laminated

glass, and composite panels with high levels

of Sound Reduction Index (SRI) for sound reduction.

Green facade elements like vertical gardens

provide natural acoustic barriers and aesthetics.

Proper sealing of façade joints minimizes sound

transmission, creating a more comfortable, quieter

indoor climate with better acoustic performance.

SOLAR SHADING

Solar heat gain is minimized by dynamic shading

systems by up to 70%, maximizing thermal comfort

and energy conservation.

*4

*1

This image represents a futuristic green and sustainable

building, designed and visualized using AI rendering technology.

*3

*2

Dila Dil

94

MID DESIGN CONCEPTS


d Comfort: Winter Semester 2024-2025

rchitecture for a Sustainable Future

THERMAL

PERFORMANCE

Optimizing thermal performance ensures comfort and

reduces energy use. High thermal mass materials

stabilize indoor temperatures.

Heat fluxes in transparent building structures

*7

*5

Thermal Energy

Heat transmission is by conduction, convection,

and radiation, affecting building energy balance.

Thermal boundary resistance is the resistance

to heat flow at the interface between two materials,

based on surface properties.

Thermal capacity is the capacity of a material to

store heat, buffering indoor temperatures and

enhancing comfort.

Heat transfer by building components is measured

by the U-value, taking into account the

thermal resistance of every layer.

Thermal bridges are localized hot spots of

enhanced heat loss, commonly at structural connections

or inadequately insulated details.

MOISTURE AND

HYGIENE

Effective moisture control averts condensation,

mold, and structural damage and preserves

healthy indoor environments.

*6

Illustration of Basement Foundation Showing

Drainage and Damp Proofing Only

VENTILATION

Ventilation ensures indoor air quality without

wasting excessive energy. Hybrid systems offer a

compromise between natural and mechanical

ventilation.

een and sustainable

g AI rendering technology.

Heat fluxes in transparent building structures

Design Principles of Solar Building

• Orientation and Shading: Buildings are oriented to receive maximum sunlight throughout the year.

• Solar Panel Integration: Solar panels are integrated with building envelopes and roofs. BIPV systems have

been used as a visually appealing and efficient method to generate solar energy.

• Energy Efficiency: In addition to the use of solar energy, energy efficient materials such as insulation, high-efficiency

lighting, and high-end HVAC systems have been used.

• Passive Solar Design: Passive solar design methods such as natural light and daylight for lighting and heating

have been used in conjunction with active solar systems, increasing overall energy efficiency.

MID 1040

Sustainability, Climate and Comfort

Winter Semester 2024-2025 Poster


*8

Dila Dil

MID DESIGN CONCEPTS


95

SUSTAINABILITY, CLIMATE AND COMFORT

MID 1040

OMAR SHAZI ALIKKAL

ACOUSTIC PERFORMANCE

Soundscape studies,take a broader and more humanfocused

view of urban sound environments. Instead of

just reducing unwanted noise, this approach

emphasizes the importance of context, the sounds

people enjoy, and individual preferences.

SOLAR GEOMETRY

Location of the sun relative to a horizontal plane

Azimuth: Measures the sun's direction on the

horizontal plane (compass direction).

Altitude: Measures the sun's height above the horizon.

SUN PATH DIAGRAM

FIG 5. Solar angles

A sun path diagram tracks the sun's sky movements

throughout the day and year to help designers optimize

building design while understanding light exposure.

FIG 1. Soundscape investigation

WEIGHTED SOUND REDUCTION INDEX (RW)

Rating used to measure and indicate how effective a

soundproofing wall, system or material is. Rw is based on

the amount of sound that can be transmitted through a

noise wall.

FIG 6. Sun Path Diagram

FIG 2. Comparison of profiles

FIG 3. Shadow Box

FLANKING

Flanking sound (or flanking noise) is sound that transmits

between spaces indirectly, going over or around, rather

than directly through the main separating element.

HORIZONTAL SHADOW ANGLE (HSA) AND

VERTICAL SHADOW ANGLE (VSA)

The application of HSA and VSA principles remains

essential for architects and designers to develop

successful solar shading systems for buildings.

FIG 7. vertical and horizontal shading

INTERACTION OF SUN WITH BUILDING ENVELOPE

FIG 3. Flanking of Noise Through Different Surfaces

SOUND ABSORPTIONS BY FAÇADES

The absorption techniques

used in facade design serve as

essential sound control

methods to enhance acoustic

performance by implementing

specialized materials including

acoustic panels and porous

materials and acoustic

insulation.

FIG 4. Textile noise protection facade

Reduction factor Fc

0.1 <FC<0.4

Shading Coefficient Sc

Sc=g window /g 4mm float

Total energy transmiss

g-total = g window*Fc

Omar Shazi Alikkal

96

MID DESIGN CONCEPTS


ENERGY EFFICIENVY

Building energy efficiency describes the practice of

minimizing energy usage for heating and cooling and

lighting and powering the building without compromising

comfort levels. The integration of renewable energy

systems such as solar panels helps to reduce

dependence on non-renewable energy sources while

making buildings more sustainable.

THERMAL PERFORMANCE

The thermal performance of a building refers to its

ability to maintain comfortable indoor temperatures by

minimizing heat loss in winter and heat gain in summer.

It depends on factors like insulation, airtightness,

glazing, thermal mass, and ventilation. A well-designed

building with good thermal performance reduces energy

use, lowers costs, and ensures comfort while

contributing to sustainability.

BUILDING ENERGY ACT (GEG 2020)

BIPV

BIPV sets itself apart from standard photovoltaics,

because BIVP takes control of the typical functions of

cladding and it is well integrated into an architecturally

artistic and aesthetic background. Architects have

designated photovoltaics as new, interesting and

designable building components.

HEAT TRANSFER COEFFICIENT (U-VALUE)

A building element's U-value indicates how quickly heat

flows through it. Lower U-values indicate better

insulation performance because heat transmission

occurs more slowly.

FIG 8. Layers of BIPV

DIFFERENT MODULE TYPES

FIG 9. Different wall types

HEAT TRANSFER IN ALUMINUM PROFILE

The thermal break is a non-conductive barrier (typically

made of polyamide or other insulating materials)

inserted between the inner and outer sections of the

aluminum profile.Thermal break reduces heat transfer

across the profile, maintaining a higher surface

temperature on the interior side

FIG 10. Thermal Analysis

BIPV CAN BE INTEGRATED IN MANY WAYS

THERMAL BRIDGING

Thermal bridges, also known as cold bridges, are areas

of the building envelope where the heat flow is different

compared with the surrounding areas.

Cold bridges are caused by material or geometry

FIG 11. Causes of Thermal Bridge

MID DESIGN CONCEPTS


97

[1]

[2]

EN 13830:2015, Curtain walling - Product standard.

DIN 4109-35:2016, Sound insulation in buildings – Part 35: Data for verification of sound

insulation(component catalogue) – Elements, windows, doors, curtain walling.

In accordance with the ift RESEARCH REPORT (March 2017) “Developing a component catalogue

. Facade Information

for determining 1 . Facade airborne Information sound insulation as well as flanking sound insulation of curtain walling”

by ift Rosenheim, an area-based energy calculation of Rw,res has been carried out for the user

Profile System:

FWS 50

Insulating glass

defined window Profile System: unit.

FWS 50

Insulating glass

Facade major mullion: 536850

Glass ID

Makeup

Facade major mullion: 536850

Glass ID

Makeup

The following Facade are minor taken mullion: into account: -- official 1-4 test certificates, 6-12-4-12-4 (38 mm) results of internal profile

Facade minor mullion: -- 1-4 6-12-4-12-4 (38 mm)

measurements Facade as transom: well as national 322440 and international correction factors in accordance with DIN EN

Facade transom:

322440

4109-35:2016 Facade and secondary EN 13830:2015.The transom: -- output value Rw,res currently does not take account of the

safety coefficients Facade secondary specified transom: in national -- standards for the calculation.

Project Name:

Project Name:

Project Location:

Location: Name:

Location:

3 4

3 4

Date:

Date:

By:

By:

Acoustic Report

Acoustic Report

Field Glass Details Glass Rw(dB) Dimension(mm) Field Area(m²)

1 2

1 2

1 6-12-4-12-4 (38 mm) 36 1275.0 x 2725.0 3.474

2 6-12-4-12-4 (38 mm) 36 1275.0 x 2725.0 3.474

3 6-12-4-12-4 (38 mm) 36 1275.0 x 2725.0 3.474

4 6-12-4-12-4 (38 mm) 36 1275.0 x 2725.0 3.474

1,250mm

1,250mm

1,250mm

n Infill ID 2,500mm

1,250mm

n Infill ID 2,500mm

Library DEtmold

Library DEtmold

Germany Library . DEtmold

Germany

Germany

1/2

1/2

2/2

Jan. 08. 2025

Jan. 08. 2025

Zahra Parsafar Date: Jan. 08. 2025

Zahra Parsafar

By: Zahra Parsafar

Frequency, Hz / dB* Rw C Ctr OITC STC

125 250 500 1000 2000 4000

24 28 34 48 39 56

37 -2 -5 29 37

*The values expressed in the frequency table correspond to the central values of the 1/3 octave band

Disclaimer: The acoustic performance data provided in the reports is based on a test protocol or an estimation

and may be used if user actual glazing is identical to input data described herein. Acoustic performance data

herein is only applicable for glazing dimensions 1,23 m x 1,48 m (as per testing standard). Estimation of acoustic

performance is based on component-similarity assumptions which are derived from measured data and

interpolation to expand the database of values from test protocols. Due to inherent variations in acoustic

performance when testing in accordance with EN ISO 10140-3/EN ISO 10140-2, some variation in the calculated

performance can also be expected. As such, the weighted performance, Rw, and adaptation terms, C and Ctr,

should typically be considered to be accurate within ±2 dB. However, wider deviations can occur. Actual

performance may vary according to the glazing dimensions, frame system, noise sources and many other

parameters. The acoustic performance data herein should not be used as a substitute for tests of actual glazing.

For more information, please consult Assumptions and Terminology section in Guardian Acoustic Assistant. By

accessing this calculator, you agree not to alter or modify the generated report data and information, by any

means. Any manual alteration will be your own responsibility and will annul all the content of the report.

Wednesday, January 8, 2025 | Acoustic database 20221229

Acoustic Report

Mineral Rockwool

Concrete Slab

Mullion

Attachment system

Outer Gasket

Cladding

Mineral Rockwool

Concrete Slab

Insulation

Transom

Cover Cap

Transom profile

SI isolator for

increased thermal

insulation

Mullion profile

Inner gasket

Sustainability

Climate

and Comfort

S e m e s t e r R e p o r t W i S e 2 0 2 4

P r e p a r e d b y

Z a h r a P a r s a f a r

Assessment of Facade Acoustic Performance

Bibliothek der Hochschule für Musik Detmold

Façade acoustic performance assessment is vital in urban design,

focusing on sound absorption, reflection, and transmission. It

includes sound pressure measurements, material evaluation,

and balancing acoustics with aesthetics for optimized spaces.

Acoustic

Performance

Acoustic performance in architecture is crucial for comfort, functionality, and

sustainability, categorized as follows:

Facade Acoustics: Facades are critical for sound insulation, reducing external noise

and enhancing urban soundscapes

Room Acoustics: Focuses on clarity and reverberation

Shorter reverberation times improve speech intelligibility, while longer times suit music.

Interspatial Acoustics: Reduces noise transmission between spaces, maintaining

privacy.Environmental Acoustics: Manages urban and natural noise for pleasant

environments

Mechanical Acoustics: Limits noise from HVAC systems and machinery to enhance

interior comfort.

Sound Pressure Levels

Sound Source Identification

Curtain-wall detailes

BPSolver

2. Codes and Specifications

Rw Calculation

3. Results BPSolver

Rw,res = 35 dB

2,700mm

2,700mm

2,700mm

2,700mm

5,400mm

5,400mm

Acoustic Performance

Glazing Configuration

6mm Float Glass

12mm Cavity

6mm Float Glass

12mm Cavity

6mm Float Glass

Sound Reduction Indices

Soundscape Radar Plot

Soundscape Descriptor

Solar Shading

Energy Resources:

Commercial Primary Energy / Renewable Energy

Key Principles

Soundscapes: Integrate natural and man-made sounds to influence well-being and

behavior.

Sound Interaction: Surfaces reflect, absorb, or scatter sound.

Design Impacts: Façades must address sound absorption, emissions, and insulation

to comply with regulations and improve living standards in urban settings.

Vertical facades

Solar Physical Effects in Matter

Solar Diagram

Zahra Parsafar

98

MID DESIGN CONCEPTS


Energy Efficency

Reducing energy use while maintaining functionality through

insulation, efficient systems, and appliances.

Benefits: Cuts energy consumption, lowers costs, reduces

environmental impact, and promotes sustainability by reducing

reliance on non-renewable resources.


Warm air, holds more moisture cooling increases humidity, causing condensation.

Excess indoor moisture from activities increases risks of mold and frost damage.

Solar Technology

Photovoltaic Effect

Converts sunlight into electricity via semiconductors like silicon.

Water Transport Mechanisms

Capillary Action: Water rises against gravity in small pores.

Diffusion/Effusion: Movement through porous materials depends on pore size and

vapor pressure

Cold Bridges

Risks: Heat loss, condensation, and mold from design or material properties.

Single-Shell Walls

Composite Systems

Interior Insulation

Rear-Ventilated Walls

Components

Panels, inverters (convert DC to AC), and grid connection.

Thermal Performance

Thermal Energy and Comfort

Heat is energy from kinetic activity of molecules; sensed as temperature.

Thermal comfort is balancing heat production and dissipation.

Ventilation

Airtightness and Ventilation

Fresh air ensures health and comfort; ventilation removes stale

air and regulates CO2 levels (ideal <0.15%).

Heat Transmission Mechanisms

Conduction: Heat transfer through solids; efficiency depends on material density and

structure.

Convection: Heat movement via airflow; impacted by boundary resistances.

Radiation: Heat emitted as electromagnetic waves; intensity increases with

temperature

Ventilation Types

Natural: Window or airflow-based.

Mechanical: Controlled systems, essential in airtight modern

buildings.

Single-Shell Walls

Composite Systems

Interior Insulation

Rear-Ventilated Walls

Thermal Behavior in Building Systems

Wall Systems

Concrete walls transfer heat based on material density and insulation.

Insulation (interior/exterior) reduces heat flow but requires moisture control.

Rear-ventilated walls use convection for condensation management.

U-value: Measures heat transfer through structures; lower values indicate better

insulation.

MID DESIGN CONCEPTS


99

MID 1040 Sustainability, Climate and Comfort | Semester Report| Winter Semester 2024-2025

Lecturers: Alvaro Balderrama | Manfred Starlinger | Prof. Daniel Arztmann

Assessment of Facade Acoustic Performance | Sound Pressure Levels

Submitted by: Zahra Tahmasbi

Acoustic Performance

Noise effects on humans

noise and health:

• Nighttime noise: Sleep disruption

• Vulnerable groups: Higher risk

• Poor sleep: Stress & chronic disease

• Long-term noise: Heart disease & death

• Traffic noise: Cardiovascular risks

• Urban noise: Higher illness rates

• Decibel increase: Increased disease risk

• WHO noise limits: Health protection

• Natural sounds: Mental/physical benefits

• Lack of nature sounds: Increased stress

Assessment of Facade Acoustic Performance

Bibliothek der Hochschule für Musik Detmold

Winter Semester 25/24

Site Analysis

Sound Pressure Levels

Area 1 | Sound pressure = -59.9

Noise Map

WWW.GoogleMaps.com


Solar Shading

Solar geometry

Earth’s orbit & axial tilt: Cause of seasons

Hemispheres tilted: Varying sunlight

Tilt towards sun: Summer (longer days, warmer)

Tilt away from sun: Winter (shorter days, colder)

Cyclical tilt/orbit: Annual seasonal pattern





Assessment of Facade Acoustic Performance | Sound Source Identification |

Sound Frequency Source Content Identification | Frequency Content

Area 1

Area 2

Declination angle: Sun’s rays vs. Earth’s equator

Positive declination: Sun north of equator

Negative declination: Sun south of equator

Influences solar radiation: At different latitudes

Day length: Varies by latitude

Tilt/orbit: Cause of change

Equator: Consistent 12 hours

Poles: Extreme variation

Summer: Long days at poles

Winter: Short days at poles

Day length: Influences seasons

Area 3

Area 4

Composition of global radiation & Typical irradiation

figures on horizontal plane

Soundscape

Section - 01

Area 5

Area 6

Insolation on vertical facades at different altitudes

Assessment of Facade Acoustic Performance | Soundscape Assessment & Interaction of sun with building envelope

Soundscape Radar Plot

Application and Equipments

Assessment of Facade of Facade Acoustic Acoustic Performance | | Soundscape Assessment

Section Section - 01 - 01

Assessment of Facade Acoustic Performance | Soundscape Assessment

Section - 01

Soundscape Radar Radar Plot Plot

Soundscape Radar Radar Plot Plot

A soundscape is:how we

experience and react to

the sounds around us. The

soundscape approach focuses on

the value of sound in everyday life

and uses research to understand

how people perceive sounds in

different environments.

6

5

4

3

2

6 6

5 1

5

4

4

3

Eventful Vibrant Pleasant Calm Uneventful Monotonous Annoying Chaotic 3

2

2

3 3 5 4 3 3 4 3 Area 1

1

1

4 3 2 2 3 2 4 4 Area 2

Eventful Eventful Vibrant Calm Uneventful Monotonous Annoying Vibrant Pleasant Pleasant Chaotic

Calm Eventful 3 Vibrant Pleasant Calm Uneventful 2 Monotonous2 Annoying 4Chaotic

4 1 1 5 Area 3

3 3 Area 3 3 5 4 3 33 4 3 1

3 3 5 4 3 4 3 Area 1

3 5 4 3

3 5 4 2 1 3 2 4 Area 4

4 3 2 2 3 22 4 4 Area 2

4 3 2 2 3 4 3 2 2 3 4 4 Area 2

4 3 1 1 2 4 5 Area 3

4 34 2 1 3 2 5 Area 4 Area 5

3 1 1 2 22 4 5 3

4 3 1 1 2

3 2 1 3 22 4 5 4

4 3 2 1 3 4 3 2 1 3 2 4 5 Area 4

3 24 2 2 3 4 Area 4 Area 6

4 3 2 1 3 22 5 4 Area 5

4 3 2 1 3 4 3 2 1 3 2 5 4 Area 5

3 2 2 2 3 22 4 4 Area 6

3 2 2 2 3 3 2 2 2 3 2 4 4 Area 6



Technical Solutions for daylight control

Illuminance Value

Venetian blinds; 2 Independent

segments

Scattering systems

Glazing with mirro profiles

Solid transparent profiles

in glazing

Slats with 2 functional Areas

Slat structures in transparent

Material

Sound Quality Visual Quality Appropriateness Perceived Loudness

Sound Sound Quality 3 QualityVisual Quality Visual 3 Quality Appropriateness Appropriateness 2 Perceived Perceived 3Loudness

LoudnessArea 1

3 3 2 34 Area 21

3 3 2 3 3 2 3 Area 1

2 2 3 43 Area 32

3 3 2 3 3 2 4 Area 2

1 43

2

Visual

2 3

Appropriateness

3

Perceived

Area 3

2

Sound Quality

2 2

Quality

3 3 32 Area

Loudness

1 1 2 1 3 5 3 21 2 Area 54

1 2 Area 4

3 Area 3 3 2 1

5 1 5

1 1 5 1 Area 65

1 1 1 1 5 Area

1 1 5 14 Area 6Area 3 3 2 2

1 1 5 1 Area 6

3 Area 2 2 3 3

1 2 3 2 Area 4

1 1 5 1 Area 5

1 1 5 1 Area 6

Moveable blinds

Light shelf

Zahra Tahmasbi

100

MID DESIGN CONCEPTS


Connection of PV modules in series

series-parallel

series-parallel

Thermal Performance

Building Energy Act (GEG 2020) | Reference Building

for Residentials

Issues and parameters related to condensation

central inverter in higher-voltage

systems

central inverter or multiple

inverters

Mould growth at window Mould Damage to building materials

growth due to temperature drop in Microbiological contamination and

corners and roller shutter casing. chipping caused by moisture in

wooden parts.

String inverters

inverters for invidual modules

Heat transfer Coefficient

Structural damage Rising moisture

on an interior wall with grid for

humidity measurement.

Humidity measurement in a

construction element Destructive

humidity measurement of building

moisture in borehole.

Energy Efficiency

Classification of methods for solar energy utilization

Humidity measurement on building

material Non-destructive humidity

measurement of moisture on

building material.

Thermal Insulation in exterior walls

Sample taking Sample taking

of the plaster to measure the

moisture within the near-surface

wall structure.

Rose›s Six Phases of Moisture Absorption in Porous Materials

Solar Thermal Energy Systems

Flat plate collector

Cylindrical parabolic concentrating

collector

Thermal Insulation in exterior walls

Flat plate collector

Wall construction with thermal

insulation composite system

Ventilation

Solar air heater

Paraboloid concentrating collector

Wall construction with interior

insulation

Rear-ventilated wall construction

Ventilation openings in the façade

Ventilation through window Ventilation through window with

exterior impact pane

Air exchange rate [1/h]: 0.5 - 20 Air exchange rate [1/h]: 0.5 - 5

Adjustability: Medium

Adjustability: Low

Adjustability: Low

Adjustability: High

Forced circulation water heating

system

Solar water heater

Ventilation Flaps

Air exchange rate [1/h]: 1 - 3

Adjustability: Low

Adjustability: Low

Gap Ventilation

Air exchange rate [1/h]: 0.5 - 2

Adjustability: High

Adjustability: High


Organisations & Certificates related to Energy Efficiency

LEED

BREEAM

DGNB

The Building Envelope - Facade

Water Vapor Pressure

Building-relevant types of water

Ventilation Openint (Sensor or

pressure control)

Air exchange rate [1/h]: 0.5 - 2

Adjustability: Low- medium

Adjustability: Very high

Ventilation-related energy loss

Ventilation Types:

Natural Ventilation:

Relies on air pressure

differences to drive airflow,

typically through

opening windows. Temperature

differences or

the “chimney effect”

(warm air rising) can

also help.

Mechanical Ventilation:

Uses systems to control

air exchange.

MID DESIGN CONCEPTS


101

5. EVENTS

102 DOKUMENTATION - KM EXKURSION

EVENTS

Visit to Schüco’s Headquarters / Hands-on Workshop (FWS 50)

Bielefeld, October 10th 2024

First-semester students from the MID-FD

visited Schüco’s headquarters in Bielefeld for an

immersive learning experience led by Mr. Ulrich

Artmann. The visit combined theoretical insights

with hands-on practice.

The day began with a lecture on stick constructions,

focusing on the FWS 50 system, followed by a

guided tour of the campus. At the Welcome Forum,

students engaged in informal discussions over

breakfast before exploring the showroom’s latest

technological advancements.

In the afternoon, students participated in

a practical workshop at the training center,

assembling an FWS 50 prototype to deepen their

understanding of its components and installation.

“This visit provided valuable exposure to cuttingedge

façade technologies, bridging academic

learning with industry practice.”

- Marie Al Helou

Pictures by Dila Dil

EVENTS


103

EVENTS

Visit to AGC Interpane

Lauenförde, November 07th 2024

Students from the first and third semester of

the MID Façade Design program had the unique

opportunity to visit the production plant of the

glass company AGC Interpane in Lauenförde.

The visit began with an insightful presentation led

by Yannick Rehmet and Björn Bender, offering an

in-depth overview of the latest innovations in glass

processing. The hosts introduced AGC’s cuttingedge

technology and showcased some of the

company‘s most notable projects, emphasizing

the advancements in glass production and the

role it plays in modern façade design.

After the presentation, the students were

guided through the glass production facility.

They were introduced to the various stages of

glass processing, providing an understanding

of the intricate steps involved in creating highperformance

glass used in façades.

“This exposure helped reinforce the theoretical

concepts we had learned in the classroom, creating

a clear connection with real-world applications in

façade design.”

- Marie Al Helou

Pictures by Dila Dil

104 EVENTS


Scchhüccoooooo AAOC Woooooorrkshhoooooop – AA Daaaay oooooof Leaaaarrnnnnniinnnnng aaaannnnnd Innnnnnnnnnoooooovaaaatiioooooon

BBiiiiiiiieeeeeeeelllllllleeeeeeeeffffffffeeeeeeeelllllllldddddddd,,,, DDDDeeeeeeeecccccccceeeeeeeemmmmmmbbbbbeeeeeeeerrrrrrrr 12222,,,, 2222022224

MMMIIDDDD SSSSSSS66 ccccccccllllllllaaaaaaaassssssssssssssss wwwwwwwwaaaaaaaassssssss iiiiiiiinnnnnnnnvvvvvvvviiiiiiiitttttttteeeeeeeedddddddd ttttttttoooooooo SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss

hhhhhhhheeeeeeeeaaaaaaaaddddddddqquuuuuuuuaaaaaaaarrrrrrrrtttttttteeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn BBiiiiiiiieeeeeeeelllllllleeeeeeeeffffffffeeeeeeeelllllllldddddddd ffffffffoooooooorrrrrrrr aaaaaaaannnnnnnn eeeeeeeennnnnnnnggggggggaaaaaaaaggggggggiiiiiiiinnnnnnnngggggggg aaaaaaaannnnnnnndddddddd

hhhhhhhhaaaaaaaannnnnnnnddddddddssssssss---oooooooonnnnnnnn wwwwwwwwoooooooorrrrrrrrkkksssssssshhhhhhhhoooooooopppppppp ffffffffooooooooccccccccuuuuuuuusssssssseeeeeeeedddddddd oooooooonnnnnnnn SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss

AAddddddddvvvvvvvvaaaaaaaannnnnnnncccccccceeeeeeeedddddddd FFFaaaaaaaaççaaaaaaaaddddddddeeeeeeee CCoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm... TTTThhhhhhhheeeeeeee ddddddddaaaaaaaayyyyyyyy

bbbbbeeeeeeeeggggggggaaaaaaaannnnnnnn wwwwwwwwiiiiiiiitttttttthhhhhhhh aaaaaaaannnnnnnn iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmaaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee tttttttthhhhhhhheeeeeeeeoooooooorrrrrrrreeeeeeeettttttttiiiiiiiiccccccccaaaaaaaallllllll lllllllleeeeeeeeccccccccttttttttuuuuuuuurrrrrrrreeeeeeee lllllllleeeeeeeedddddddd

bbbbbyyyyyyyy MMMrrrrrrrr... 4lllllllliiiiiiii AArrrrrrrrttttttttmmmmmmaaaaaaaannnnnnnnnnnnnnnn,,,, wwwwwwwwhhhhhhhhoooooooo ddddddddiiiiiiiissssssssccccccccuuuuuuuusssssssssssssssseeeeeeeedddddddd tttttttthhhhhhhheeeeeeee

ccccccccaaaaaaaappppppppaaaaaaaabbbbbiiiiiiiilllllllliiiiiiiittttttttiiiiiiiieeeeeeeessssssss aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnnnnnnnnnoooooooovvvvvvvvaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ooooooooffffffff SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss AAOCC

ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm..

SSSSSSSttttttttuuuuuuuuddddddddeeeeeeeennnnnnnnttttttttssssssss hhhhhhhhaaaaaaaadddddddd tttttttthhhhhhhheeeeeeee uuuuuuuunnnnnnnniiiiiiiiqquuuuuuuueeeeeeee ooooooooppppppppppppppppoooooooorrrrrrrrttttttttuuuuuuuunnnnnnnniiiiiiiittttttttyyyyyyyy ttttttttoooooooo vvvvvvvviiiiiiiissssssssiiiiiiiitttttttt aaaaaaaa

nnnnnnnneeeeeeeewwwwwwwwllllllllyyyyyyyy ccccccccoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuucccccccctttttttteeeeeeeedddddddd ppppppppaaaaaaaavvvvvvvviiiiiiiilllllllliiiiiiiioooooooonnnnnnnn tttttttthhhhhhhhaaaaaaaatttttttt uuuuuuuuttttttttiiiiiiiilllllllliiiiiiiizeeeeeeeedddddddd tttttttthhhhhhhheeeeeeee

iiiiiiiinnnnnnnnnnnnnnnnoooooooovvvvvvvvaaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee Grrrrrrrriiiiiiiidddddddd--- 2222 ---SSSSSSShhhhhhhheeeeeeeellllllllllllllll ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm,,,, sssssssshhhhhhhhoooooooowwwwwwwwccccccccaaaaaaaassssssssiiiiiiiinnnnnnnngggggggg tttttttthhhhhhhheeeeeeee

iiiiiiiimmmmmmpppppppprrrrrrrreeeeeeeessssssssssssssssiiiiiiiivvvvvvvveeeeeeee ffffffffrrrrrrrreeeeeeeeeeeeeeee---ffffffffoooooooorrrrrrrrmmmmmm ppppppppoooooooossssssssssssssssiiiiiiiibbbbbiiiiiiiilllllllliiiiiiiittttttttiiiiiiiieeeeeeeessssssss ooooooooÄeeeeeeeerrrrrrrreeeeeeeedddddddd bbbbbyyyyyyyy tttttttthhhhhhhhiiiiiiiissssssss

ddddddddeeeeeeeessssssssiiiiiiiiggggggggnnnnnnnn aaaaaaaapppppppppppppppprrrrrrrrooooooooaaaaaaaacccccccchhhhhhhh... TTTThhhhhhhhiiiiiiiissssssss vvvvvvvviiiiiiiissssssssiiiiiiiitttttttt aaaaaaaalllllllllllllllloooooooowwwwwwwweeeeeeeedddddddd tttttttthhhhhhhheeeeeeeemmmmmm ttttttttoooooooo sssssssseeeeeeeeeeeeeeee

hhhhhhhhoooooooowwwwwwww ccccccccuuuuuuuuttttttttttttttttiiiiiiiinnnnnnnngggggggg---eeeeeeeeddddddddggggggggeeeeeeee tttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggyyyyyyyy iiiiiiiissssssss aaaaaaaapppppppppppppppplllllllliiiiiiiieeeeeeeedddddddd iiiiiiiinnnnnnnn rrrrrrrreeeeeeeeaaaaaaaallllllll---

wwwwwwwwoooooooorrrrrrrrlllllllldddddddd

pppppppprrrrrrrroooooooojeeeeeeeeccccccccttttttttssssssss..

FFFoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg aaaaaaaa rrrrrrrreeeeeeeeffffffffrrrrrrrreeeeeeeesssssssshhhhhhhhiiiiiiiinnnnnnnngggggggg bbbbbrrrrrrrreeeeeeeeaaaaaaaakkkffffffffaaaaaaaasssssssstttttttt aaaaaaaannnnnnnndddddddd aaaaaaaa ddddddddeeeeeeeelllllllliiiiiiiicccccccciiiiiiiioooooooouuuuuuuussssssss

lllllllluuuuuuuunnnnnnnncccccccchhhhhhhh aaaaaaaatttttttt tttttttthhhhhhhheeeeeeee SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo MMMeeeeeeeennnnnnnnssssssssaaaaaaaa,,,, tttttttthhhhhhhheeeeeeee aaaaaaaafffffffftttttttteeeeeeeerrrrrrrrnnnnnnnnoooooooooooooooonnnnnnnn

sssssssseeeeeeeessssssssssssssssiiiiiiiioooooooonnnnnnnn sssssssshhhhhhhhiiiiiiiifffffffftttttttteeeeeeeedddddddd ttttttttoooooooo aaaaaaaa hhhhhhhhaaaaaaaannnnnnnnddddddddssssssss---oooooooonnnnnnnn ffffffffaaaaaaaabbbbbrrrrrrrriiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn

wwwwwwwwoooooooorrrrrrrrkkksssssssshhhhhhhhoooooooopppppppp... TTTThhhhhhhhiiiiiiiissssssss sssssssseeeeeeeeggggggggmmmmmmeeeeeeeennnnnnnntttttttt ffffffffooooooooccccccccuuuuuuuusssssssseeeeeeeedddddddd oooooooonnnnnnnn SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo

AAdddddddddddddddd---oooooooonnnnnnnn CCoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss ffffffffoooooooorrrrrrrr ttttttttiiiiiiiimmmmmmbbbbbeeeeeeeerrrrrrrr,,,, wwwwwwwwhhhhhhhheeeeeeeerrrrrrrreeeeeeee ssssssssttttttttuuuuuuuuddddddddeeeeeeeennnnnnnnttttttttssssssss

aaaaaaaaccccccccttttttttiiiiiiiivvvvvvvveeeeeeeellllllllyyyyyyyy ppppppppaaaaaaaarrrrrrrrttttttttiiiiiiiicccccccciiiiiiiippppppppaaaaaaaatttttttteeeeeeeedddddddd iiiiiiiinnnnnnnn bbbbbuuuuuuuuiiiiiiiillllllllddddddddiiiiiiiinnnnnnnngggggggg aaaaaaaa pppppppprrrrrrrroooooooottttttttoooooooottttttttyyyyyyyyppppppppeeeeeeee... TTTThhhhhhhhiiiiiiiissssssss

pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiiccccccccaaaaaaaallllllll eeeeeeeexxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee pppppppprrrrrrrroooooooovvvvvvvviiiiiiiiddddddddeeeeeeeedddddddd tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnncccccccceeeeeeee ttttttttoooooooo ggggggggaaaaaaaaiiiiiiiinnnnnnnn

aaaaaaaa ddddddddeeeeeeeeeeeeeeeeppppppppeeeeeeeerrrrrrrr uuuuuuuunnnnnnnnddddddddeeeeeeeerrrrrrrrssssssssttttttttaaaaaaaannnnnnnnddddddddiiiiiiiinnnnnnnngggggggg ooooooooffffffff tttttttthhhhhhhheeeeeeee ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm'ssssssss

ccccccccoooooooommmmmmppppppppoooooooonnnnnnnneeeeeeeennnnnnnnttttttttssssssss aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnssssssssttttttttaaaaaaaallllllllllllllllaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn mmmmmmeeeeeeeetttttttthhhhhhhhooooooooddddddddssssssss,,,, wwwwwwwwhhhhhhhhiiiiiiiilllllllleeeeeeee aaaaaaaallllllllssssssssoooooooo

Scchhüccoooooo AAOC Woooooorrkshhoooooop – AA Daaaay oooooof Leaaaarrnnnnniinnnnng aaaannnnnd Innnnnnnnnnoooooovaaaatiioooooon

lllllllleeeeeeeeaaaaaaaarrrrrrrrnnnnnnnniiiiiiiinnnnnnnngggggggg vvvvvvvvaaaaaaaalllllllluuuuuuuuaaaaaaaabbbbblllllllleeeeeeee ttttttttiiiiiiiippppppppssssssss ffffffffrrrrrrrroooooooommmmmm SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo eeeeeeeexxxppppppppeeeeeeeerrrrrrrrttttttttssssssss..

BBiiiiiiiieeeeeeeelllllllleeeeeeeeffffffffeeeeeeeelllllllldddddddd,,,, DDDDeeeeeeeecccccccceeeeeeeemmmmmmbbbbbeeeeeeeerrrrrrrr 12222,,,, 2222022224

TTTThhhhhhhhiiiiiiiissssssss wwwwwwwwoooooooorrrrrrrrkkksssssssshhhhhhhhoooooooopppppppp iiiiiiiissssssss ppppppppaaaaaaaarrrrrrrrtttttttt ooooooooffffffff aaaaaaaa lllllllloooooooonnnnnnnngggggggg---ssssssssttttttttaaaaaaaannnnnnnnddddddddiiiiiiiinnnnnnnngggggggg ttttttttrrrrrrrraaaaaaaaddddddddiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn

wwwwwwwwiiiiiiiitttttttthhhhhhhhiiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee MMMIIDDDD FFFDDDD pppppppprrrrrrrrooooooooggggggggrrrrrrrraaaaaaaammmmmm,,,, ccccccccoooooooommmmmmbbbbbiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg

MMMIIDDDD SSSSSSS66 ccccccccllllllllaaaaaaaassssssssssssssss wwwwwwwwaaaaaaaassssssss iiiiiiiinnnnnnnnvvvvvvvviiiiiiiitttttttteeeeeeeedddddddd ttttttttoooooooo SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss

tttttttthhhhhhhheeeeeeeeoooooooorrrrrrrreeeeeeeettttttttiiiiiiiiccccccccaaaaaaaallllllll kkknnnnnnnnoooooooowwwwwwwwlllllllleeeeeeeeddddddddggggggggeeeeeeee aaaaaaaannnnnnnndddddddd pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiiccccccccaaaaaaaallllllll eeeeeeeexxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee

hhhhhhhheeeeeeeeaaaaaaaaddddddddqquuuuuuuuaaaaaaaarrrrrrrrtttttttteeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn BBiiiiiiiieeeeeeeelllllllleeeeeeeeffffffffeeeeeeeelllllllldddddddd ffffffffoooooooorrrrrrrr aaaaaaaannnnnnnn eeeeeeeennnnnnnnggggggggaaaaaaaaggggggggiiiiiiiinnnnnnnngggggggg aaaaaaaannnnnnnndddddddd

iiiiiiiinnnnnnnn aaaaaaaa ccccccccoooooooollllllllllllllllaaaaaaaabbbbboooooooorrrrrrrraaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee sssssssseeeeeeeettttttttttttttttiiiiiiiinnnnnnnngggggggg... Ovvvvvvvveeeeeeeerrrrrrrraaaaaaaallllllllllllllll,,,, iiiiiiiitttttttt wwwwwwwwaaaaaaaassssssss aaaaaaaannnnnnnn

hhhhhhhhaaaaaaaannnnnnnnddddddddssssssss---oooooooonnnnnnnn wwwwwwwwoooooooorrrrrrrrkkksssssssshhhhhhhhoooooooopppppppp ffffffffooooooooccccccccuuuuuuuusssssssseeeeeeeedddddddd oooooooonnnnnnnn SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss

eeeeeeeennnnnnnnrrrrrrrriiiiiiiicccccccchhhhhhhhiiiiiiiinnnnnnnngggggggg eeeeeeeexxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee tttttttthhhhhhhhaaaaaaaatttttttt eeeeeeeennnnnnnnhhhhhhhhaaaaaaaannnnnnnncccccccceeeeeeeedddddddd tttttttthhhhhhhheeeeeeee ssssssssttttttttuuuuuuuuddddddddeeeeeeeennnnnnnnttttttttssssssss'

AAddddddddvvvvvvvvaaaaaaaannnnnnnncccccccceeeeeeeedddddddd FFFaaaaaaaaççaaaaaaaaddddddddeeeeeeee CCoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm... TTTThhhhhhhheeeeeeee ddddddddaaaaaaaayyyyyyyy

sssssssskkkiiiiiiiillllllllllllllllssssssss iiiiiiiinnnnnnnn ffffffffaaaaaaaaççaaaaaaaaddddddddeeeeeeee ccccccccoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn..

bbbbbeeeeeeeeggggggggaaaaaaaannnnnnnn wwwwwwwwiiiiiiiitttttttthhhhhhhh aaaaaaaannnnnnnn iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmaaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee tttttttthhhhhhhheeeeeeeeoooooooorrrrrrrreeeeeeeettttttttiiiiiiiiccccccccaaaaaaaallllllll lllllllleeeeeeeeccccccccttttttttuuuuuuuurrrrrrrreeeeeeee lllllllleeeeeeeedddddddd

bbbbbyyyyyyyy MMMrrrrrrrr... 4lllllllliiiiiiii AArrrrrrrrttttttttmmmmmmaaaaaaaannnnnnnnnnnnnnnn,,,, wwwwwwwwhhhhhhhhoooooooo ddddddddiiiiiiiissssssssccccccccuuuuuuuusssssssssssssssseeeeeeeedddddddd tttttttthhhhhhhheeeeeeee

JJeeeeeeeerrrrrrrriiiiiiiinnnnnnnn

JJooooooooy

ccccccccaaaaaaaappppppppaaaaaaaabbbbbiiiiiiiilllllllliiiiiiiittttttttiiiiiiiieeeeeeeessssssss aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnnnnnnnnnoooooooovvvvvvvvaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ooooooooffffffff SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo’’ssssssss AAOCC

(MMMIIDDDD SSSSSSS66 – FFFaaaaaaaaççaaaaaaaaddddddddeeeeeeee DDDDeeeeeeeessssssssiiiiiiiiggggggggnnnnnnnn)

ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm..

SSSSSSSttttttttuuuuuuuuddddddddeeeeeeeennnnnnnnttttttttssssssss hhhhhhhhaaaaaaaadddddddd tttttttthhhhhhhheeeeeeee uuuuuuuunnnnnnnniiiiiiiiqquuuuuuuueeeeeeee ooooooooppppppppppppppppoooooooorrrrrrrrttttttttuuuuuuuunnnnnnnniiiiiiiittttttttyyyyyyyy ttttttttoooooooo vvvvvvvviiiiiiiissssssssiiiiiiiitttttttt aaaaaaaa

nnnnnnnneeeeeeeewwwwwwwwllllllllyyyyyyyy ccccccccoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuucccccccctttttttteeeeeeeedddddddd ppppppppaaaaaaaavvvvvvvviiiiiiiilllllllliiiiiiiioooooooonnnnnnnn tttttttthhhhhhhhaaaaaaaatttttttt uuuuuuuuttttttttiiiiiiiilllllllliiiiiiiizeeeeeeeedddddddd tttttttthhhhhhhheeeeeeee

iiiiiiiinnnnnnnnnnnnnnnnoooooooovvvvvvvvaaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee Grrrrrrrriiiiiiiidddddddd--- 2222 ---SSSSSSShhhhhhhheeeeeeeellllllllllllllll ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmm,,,, sssssssshhhhhhhhoooooooowwwwwwwwccccccccaaaaaaaassssssssiiiiiiiinnnnnnnngggggggg tttttttthhhhhhhheeeeeeee

iiiiiiiimmmmmmpppppppprrrrrrrreeeeeeeessssssssssssssssiiiiiiiivvvvvvvveeeeeeee ffffffffrrrrrrrreeeeeeeeeeeeeeee---ffffffffoooooooorrrrrrrrmmmmmm ppppppppoooooooossssssssssssssssiiiiiiiibbbbbiiiiiiiilllllllliiiiiiiittttttttiiiiiiiieeeeeeeessssssss ooooooooÄeeeeeeeerrrrrrrreeeeeeeedddddddd bbbbbyyyyyyyy tttttttthhhhhhhhiiiiiiiissssssss

ddddddddeeeeeeeessssssssiiiiiiiiggggggggnnnnnnnn aaaaaaaapppppppppppppppprrrrrrrrooooooooaaaaaaaacccccccchhhhhhhh... TTTThhhhhhhhiiiiiiiissssssss vvvvvvvviiiiiiiissssssssiiiiiiiitttttttt aaaaaaaalllllllllllllllloooooooowwwwwwwweeeeeeeedddddddd tttttttthhhhhhhheeeeeeeemmmmmm ttttttttoooooooo sssssssseeeeeeeeeeeeeeee

hhhhhhhhoooooooowwwwwwww ccccccccuuuuuuuuttttttttttttttttiiiiiiiinnnnnnnngggggggg---eeeeeeeeddddddddggggggggeeeeeeee tttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggyyyyyyyy iiiiiiiissssssss aaaaaaaapppppppppppppppplllllllliiiiiiiieeeeeeeedddddddd iiiiiiiinnnnnnnn rrrrrrrreeeeeeeeaaaaaaaallllllll---

wwwwwwwwoooooooorrrrrrrrlllllllldddddddd

pppppppprrrrrrrroooooooojeeeeeeeeccccccccttttttttssssssss..

FFFoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg aaaaaaaa rrrrrrrreeeeeeeeffffffffrrrrrrrreeeeeeeesssssssshhhhhhhhiiiiiiiinnnnnnnngggggggg bbbbbrrrrrrrreeeeeeeeaaaaaaaakkkffffffffaaaaaaaasssssssstttttttt aaaaaaaannnnnnnndddddddd aaaaaaaa ddddddddeeeeeeeelllllllliiiiiiiicccccccciiiiiiiioooooooouuuuuuuussssssss

lllllllluuuuuuuunnnnnnnncccccccchhhhhhhh aaaaaaaatttttttt tttttttthhhhhhhheeeeeeee SSSSSSScccccccchhhhhhhhüüüccccccccoooooooo MMMeeeeeeeennnnnnnnssssssssaaaaaaaa,,,, tttttttthhhhhhhheeeeeeee aaaaaaaafffffffftttttttteeeeeeeerrrrrrrrnnnnnnnnoooooooooooooooonnnnnnnn

EVENTS

Visit to Schüco’s Headquarters / Hands-on Workshop (AOC)

Bielefeld, December 12th 2024

MID-FD students of the third semester were

invited to Schüco’s headquarters in Bielefeld

for an engaging hands-on workshop focused on

Schüco’s most innovative systems. The day began

with an informative theoretical lecture led by Mr.

Ulrich Artmann, who discussed the capabilities

and innovations of Schüco’s AOC system.

Students visited the innovative Grid2Shell pavilion,

showcasing the impressive free-form possibilities

offered by this design approach. This visit allowed

them to see how cutting-edge technology is

applied in real-world projects.

Following a lunch invitation at the Schüco Lounge,

the afternoon session shifted to a hands-on

fabrication workshop. This segment focused on

Schüco Add-on Constructions for timber, where

students actively participated in building a

prototype.

This workshop is part of a long-standing tradition

within the MID-FD program, combining theoretical

knowledge and practical experience in a

collaborative setting.

“This practical experience provided the chance

to gain a deeper understanding of the system‘s

components and installation methods, while also

learning valuable tips from Schüco experts.”

- Jerin Joy

Picture by Jerin Joy and Fady Aziz

EVENTS


105

EVENTS

MID Students at BAU 2025

Munich , January 15th – 17th 2025

In January 2025, first and third-semester

students from the Master of Integrated Design

(MID), specializing in façade and computational

design, made an educational journey to the BAU

2025 exhibition in Munich, the most renowned

construction trade fair in Germany carried out

every second year. This visit provided a valuable

opportunity for students to engage with cuttingedge

innovations shaping the built environment.

For façade design students, the exhibition halls B1,

C1, B2, B5, and C2 were particularly informative

since they engaged with various companies, gaining

insights into façade construction techniques, wall

systems, and industry trends.

A key highlight was the guided tour by Schüco, where

they showed their state-of-the-art façade systems.

Schüco’s exhibit, themed “Value Up”, emphasized

renewable energy solutions, particularly BIPV and

retrofitting systems. These innovations are crucial

for reducing energy consumption in both largescale

commercial buildings and smaller community

spaces.

From left to right: Zahra Tahmasbi, Marie Al

Helou, Anastasiia Krasnikova, Sara

Hemmatyar, and Zahra Parsafar.

The Digital BAU at the C3 exhibit showcased

groundbreaking developments in BIM, AI, and

robotics for the construction industry. One of

the most exciting aspects of this section was

the opportunity to experience live software

demos, allowing to see how these tools enhance

architectural and engineering workflows.

BAU 2025 was more than just an exhibition—it was

an immersive learning experience that connected

students with industry leaders and real-world

applications of architectural innovation.

“For us, as young architects and designers, this

visit reinforced the importance of staying at the

forefront of technological advancements and

sustainability-driven design. As the construction

industry continues to evolve, embracing

digitalization and eco-friendly solutions will be

essential in shaping a more resilient and efficient

built environment.”

Pictures by Kavyashree Govil and Dila Dil

- Kavyashree Govil

106 EVENTS


EVENTS

Presentation at 23rd Docomomo Germany Conference

Bochum, 29th of March 2025

On the 29th of March, the 23rd Docomomo

Germany conference took place at The Faculty

of Architecture at Bochum University of Applied

Sciences. The conference theme was the

interaction between education, training and the

architecture of the modern movement.

Guests from Germany and abroad with academic,

practical, activist and, of course, pedagogical

backgrounds provided an overview of the current

status in the field of “Education - Modern

Movement - Training“ in lectures, analyses,

reflections, practical reports and designs, as well

as the role that Docomomo already plays in this

context and can play in the future.

Prof. ir. Michel Melenhorst and Dipl. Ing. Janine

Tüchsen, from the contextual design department

of the Detmold School of Design, compiled the

conference programme. Student work from TH

OWL on Sustainable Campus and the Modern

Movement, Innovation Communication, Research

and Design are presented during the Conference.

The project “Re-Use” is part of the Master‘s program

MArch at TH OWL and focuses on conceptual

strategies for the sustainable transformation

and re-use of existing buildings. At the beginning

of the course, each student group was asked to

select a university, preferably one built in the postwar

period. Throughout the semester, the groups

worked on the assigned task using their chosen

university as an exemplary case study. During the

conference the contributions of the students were

presented. Raissa Haferkamp, Suara Sen, Andrea

Klein presented Kassel; Marion Bauer, Marysé

Mäding, Gül Gelöz, Evelin Focht presented Höxter;

David Böckmann, Gina-Sophie Bories, Muriel

Rummenie presented Bochum; Elmas Uprak, Ilayda

Gül Sari, Natalia Tandara, Lara Meyer presented

Bielefeld. At the end of the session, doctoral

students Nathania Nadia and Aylin Erol from TH

OWL and Promotionskolleg NRW presented their

dissertation topic on modern movement at the

conference.

- David Böckmann and Aylin Erol Picture by Aylin Erol

EVENTS


107

IMPRINT

Publisher

OWL University of Applied Sciences and Arts

IDS Institute for Design Strategies

Emilienstraße 45, D-32756 Detmold, Germany

Editors

Alvaro Balderrama

Prof. Daniel Arztmann

Layout and Graphics

Aylin Erol

Alvaro Balderrama

Guest Reviewers

Florian Zander

Johanna Götz

Cover

Alvaro Balderrama

Contributions and Illustations

Unless stated otherwise, the illustrations

belong to the respective authors in each

contribution, or to the Editorial Team. The

authors in this report are credited individually

and are responsible for their contribution.

Teaching Department

Façade Construction

Prof. Daniel Arztmann

Contact

IDS Institute for Design Strategies

OWL University of Applied Sciences and Arts

Emilienstraße 45, D-32756 Detmold

E-Mail: ids@th-owl.de

Web: www.th-owl.de/ids

Sustainable Façades volume 4

ISSN (Print) 2943-4459


IMPRINT


MORE FROM US

Sign up for our

newsletter:

Sustainable Façades volume 4

ISSN (Print) 2943-4459


Design Strategies Impulse Sustainable Facades Vol. 4

Transform your PDFs into Flipbooks and boost your revenue!

Delete template?

Save as template ?